Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription.

Similar presentations


Presentation on theme: "RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription."— Presentation transcript:

1 RNA AND PROTEIN SYNTHESIS

2 How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription 2.RNA processing 3.Translation DNA RNA ProteinDNA RNA Protein

3 DNA RNA Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

4 Before making proteins, Your cell must first make RNA Question:Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

5 RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

6

7 1. Transcription DNA strands RNAThen moves along one of the DNA strands and links RNA nucleotides together. Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

8 1. Transcription OR RNA production RNA molecules are produced by copying part of DNA into a complementary sequence of RNA This process is started and controlled by an enzyme called RNA polymerase.

9 1. Transcription DNApre-mRNA RNA Polymerase

10 Question: RNADNAWhat would be the complementary RNA strand for the following DNA sequence? DNA 5-GCGTATG-3DNA 5-GCGTATG-3

11 Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) Remember: all produced in the nucleus!Remember: all produced in the nucleus!

12 mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an from the principal to the cafeteria lady.

13 A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

14 If the cell is a school… The Nucleus is the school officeThe Nucleus is the school office The Nucleolus is the principals officeThe Nucleolus is the principals office The DNA is the principalThe DNA is the principal Ribosomes are the cafeteria ladiesRibosomes are the cafeteria ladies mRNA is the from the principal to the cafeteria ladymRNA is the from the principal to the cafeteria lady

15 rRNA Part of the structure of a ribosome Helps in protein production tRNA A go-getter. Gets the right parts to make the right protein according to mRNA instructions

16 B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

17 2. RNA Processing Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

18 2. RNA Processing IntronsexonsIntrons are pulled out and exons come together. mature RNA moleculenucleus cytoplasm.End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good!Introns bad…… Exons good!

19 2. RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

20 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

21 3. Translation - making proteins Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

22 3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG) PROTEIN!!!!Lets make a PROTEIN!!!!.

23 3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

24 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

25 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

26 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

27 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

28 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

29 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

30 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

31 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

32 End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

33 Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid.The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?What would be the DNA base code for this amino acid?

34 Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC


Download ppt "RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription."

Similar presentations


Ads by Google