Presentation is loading. Please wait.

Presentation is loading. Please wait.

Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Similar presentations


Presentation on theme: "Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes."— Presentation transcript:

1 Unlocking the mystery of DNA

2 What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes are part of a chromosome 4.Chromosomes are made of protein and DNA Prior to the 1950s

3 Cell division and DNA replication Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information

4 DNA replication – Mitosis & Meiosis

5 But… What did DNA look like, and how did it replicate itself?

6 Discovering the structure of DNA Rosalind Franklin ( ) Kings College, London Made significant advances in x- ray diffraction techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images

7 Discovering the structure of DNA Maurice Wilkins – ( ) Kings College, London Also did X-ray diffraction studies of DNA Worked with Rosalind Franklin Shared information with Watson and Crick

8 Discovering the structure of DNA Erwin Chargaff – ( ) Columbia University, NY Investigated the composition of DNA His findings by 1950 strongly suggested the base-pairings of A-T & G-C Met with Watson and Crick in 1952 and shared his findings Chargaffs rule A = T & C = G

9 Discovering the structure of DNA James Watson (1928) and Francis Crick ( ) Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

10 Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

11 DNA – What does my code look like? Computer Code: DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAG AAGAGATAAACTAGAGAGACCCTTTAAAACA CACAGAGATAGACAGAAAAACAATAGACAGA TACAGATAGACATAAAAAATTTTTTGGGAAA …millions and millions of bases…

12 Practice DNA Base Pairs

13 DNA replication – helix unzips

14

15 DNA replication – two strands are separated

16 DNA replication – each side is now a template

17 DNA replication – two identical strands of DNA Original DNA strands

18 DNA replication Newly assembled DNA strands

19 DNA replication Semi-conservative replication

20 Build a DNA molecule – you try it!

21 DNA replication- you try it!


Download ppt "Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes."

Similar presentations


Ads by Google