1. Genetic engineering to produce an organism which will make a ‘foreign’ protein:  Obtain ‘foreign’ gene  Amplify using PCR  Insert gene into a vector Then either:  (use a marker gene to identify transformed organisms)  Collect the protein produced when the gene is expressed in the transformed organism Or:  Insert gene directly into target cells for gene therapy – the gene is expressed and the functional protein is produced. Genetic engineering for analysis:  Obtain the DNA – this could be a target gene or sample of DNA for forensic analysis.  Amplify using PCR  Carry out electrophoresis – this could be for: o Genetic fingerprinting o Restriction mapping o DNA sequencing – maybe to identify the presence of a particular gene when screening so genetic counselling can be offered.

2. By the end of the lesson you should be able to Give some uses of genetic engineering. Have an overview of genetic engineering. Know how scientists obtain the DNA fragments they are interested in and amplify them using PCR.

3. Genetic engineering to produce an organism which will make a ‘foreign’ protein:  Obtain ‘foreign’ gene  Amplify using PCR  Insert gene into a vector Then either:  (use a marker gene to identify transformed organisms)  Collect the protein produced when the gene is expressed in the transformed organism Or:  Insert gene directly into target cells for gene therapy – the gene is expressed and the functional protein is produced. Genetic engineering for analysis:  Obtain the DNA – this could be a target gene or sample of DNA for forensic analysis.  Amplify using PCR  Carry out electrophoresis – this could be for: o Genetic fingerprinting o Restriction mapping o DNA sequencing – maybe to identify the presence of a particular gene when screening so genetic counselling can be offered.

4. i.e. transferring the genes of one organism into another organism

5. What is a gene? A sequence of DNA nucleotides which code for a particular protein.

6. What is a genome? The entire DNA sequence of an organism (i.e. all the DNA both coding and non-coding). The Human Genome Project successfully mapped the human genome in 2003

7. i.e. transferring the genes of one organism into another organism

8. DNA Technology overview 1.Obtain the DNA fragment required – using reverse transcriptase or restriction endonuclease enzymes 2.Amplify the fragment using PCR 3.Either: Identify fragments using electrophoresis (for sequencing, mapping or genetic fingerprinting) Or: Use fragments in gene therapy

10. 2 different enzymes can be used for this: Reverse transcriptase Restriction endonuclease.

11. Method 1 – Using reverse transcriptase: What is transcription? Therefore what do you think the enzyme reverse transcriptase does? As the DNA which is produced has complementary nucleotides to mRNA it is called complementary DNA or cDNA.

12. We can use reverse transcriptase to produce cDNA for a particular gene from that gene’s mRNA. Read page 246 and 247 of the text book and make short notes on page 21 of your booklet. 1 virus = 2 minutes

13. A bit more info: Reverse transcriptase is an enzyme found in retroviruses such as HIV.

14. Method 2 Using restriction endonuclease: The second way to isolate the gene you is done by an enzyme called a restriction endonuclease Each restriction endonuclease recognises a different DNA base sequence

15. Restriction endonuclease enzymes. E coli bacterium Eco R1 restriction enzyme Think back to your work on protein structure (module 1). Why does each enzyme molecule recognise a different DNA base sequence? The enzyme’s active site has a specific shape which is complimentary to the shape of a specific DNA base sequence. Complete the question at the bottom of page 21 in your booklet now.

16. Read the bottom of page 21 in your booklet now.

17. G A A T T C C T T A AG

18. Now complete the table at the top of page 22 (the first has been done for you).

19. CC T A G G GG A T CC

20. TT C G A A A A G C TT

21. G A C G T C C T G C AG

22. C G G A C C G G C C T G G C

23. TCCGGACCGACGTCGGTTCGAATC AGGCCTGGCTGCAGCCAAGCT TAG Use a different colour to identify where each enzyme cuts. (NB Eco R1 is not used – some of the others may not cut either)

24. TCCGGACCGACGTCGGTTCGAATC AGGCCTGGCTGCAGCCAAGCT TAG

25. Answer the summary question pg 248 text book

26. All sequences recognised by restriction enzymes are palindromes.

27. Palindromes… Was it a rat I saw?“ If I had a hi-fi. Mr. Owl ate my metal worm.