1. Attenuator Sequence AUG E * AUG D * AUG C * AUG B * AUG A * Trp structural genes P Trp O 1234 AUGUGAUUUUUUUUUUGGUGG The Trp operon is controlled by negative regulation. A repressor protein (Trp repressor) binds to the operator sequence (O) and prevents transcription. The repressor can only bind DNA if it is simultaneously binding a molecule of tryptophan. Thus when trp is present the trp operon is repressed by the trp repressor and turned off. When the amount of trp present in the bacteria decreases, trp dissociates from the trp repressor and the trp repressor can no longer bind the operator and txn occurs. However, there is still some trp present (moderate amounts) so the operon does not need to be actively transcribed Within the attenuator sequence, there are two sets of imperfect, inverted repeats. Each pair of repeats is indicated above as a colored arrow. Within repeat 1, are two trp codons (UGGUGG). Region 2 and region 3 (including dashed portion) form an inverted repeat with a single mismatch. These repeats can therefore form three possible hairpin secondary structures in the newly transcribed mRNA. In the presence moderate amounts of trp, repeats 1 & 2 will form a hairpin, leaving repeat 3 (solid portion) and repeat 4 free to form a hairpin. Formation of the 3-4 hairpin causes termination of transcription due to the presence of the 9 U’s immediately following repeat 4. This is a classical rho-independent terminator sequence. (View Slides 2-4) In the near absence of trp, ribosomes which bind and begin translation at the AUG just upstream of repeat 1 will pause when they reach the two adjacent trp codons within repeat 1. The presence of the ribosome at this position prevents a hairpin from forming between repeats1 and 2. Therefore, as RNA polymerase continues to transcribe the leader sequence, repeat 2 forms a hairpin structure with repeat 3 (dashed and solid portions) as soon as repeat 3 is transcribed. With repeats 2 & 3 forming a hairpin structure, repeat 4 remains single stranded and a termination hairpin is not formed. Termination does not occur and there is no attenuation of transcription. RNA polymerase continues through the remainder of the leader region and on through the structural genes E, D, C, B & A. (View Slides 5-7) Next Slide Trp Operon Overview

2. 1234 AUGUGAUUUUUUUUUUGGUGG Attenuation occurs in the presence of moderate amounts of trp UUUUUUUUU Ultimately, this is the secondary structure which will form if Trp is present Next Slide

3. 234 UUUUUUUUU 1 AUGUGAUGGUGG 1 AUGUGAUGGUGG 4 UUUUUUUUU Attenuation is overcome when Trp levels are very low 23 Stalled Ribosome Ultimately, this is the secondary structure formed at low concentrations of Trp Next Slide

4. AUGUGG RNA polymerase Attenuation occurs at moderately low levels of Trp The following 8 slides will play automatically to animate the process of attenuation. To begin, click the button below Transcription of the Trp operon has begun. RNA polymerase has transcribed from the +1 into the trp leader sequence. The line and boxes represent newly synthesized mRNA from the trp operon.

5. Attenuation occurs at moderately low levels of Trp A ribosome has bound to the 1 st AUG of the leader sequence and begun translation. RNA polymerase has continued transcription into region 2 12 AUGUGAUGGUGG Ribosome RNA polymerase

6. Attenuation occurs at moderately low levels of Trp Ribosome 12 AUGUGAUGGUGG RNA polymeraseShort peptide Trp-tRNA Trp RNA polymerase continues transcription of the leader sequence. Translation proceeds to the two trp codons. Since there is some (moderate) amount of trp ( ) in the cell, Trp- tRNA Trp is produced and can be used by the ribosome.

7. Attenuation occurs at moderately low levels of Trp 12 AUGUGAUGGUGG Ribosome RNA polymerase Short peptide 3 Since trp is present, translation continues through the two trp codons on to the stop codon. Transcription has continued into region 3. Termination factor

8. 12 AUGUGA 34 UGGUGG Ribosome dissociates after reaching stop codon RNA polymerase Attenuation occurs at moderately low levels of Trp Translation terminates once the ribosome reaches the stop codon. RNA polymerase has continued transcription into region 4. Attenuation occurs at moderately low levels of Trp Short peptide will be degraded

9. 3 Dissociated ribosome AUG UGA UGGUGG 1 2 RNA polymerase Attenuation occurs at moderately low levels of Trp Once the ribosome dissociates, regions 1 & 2 can and will form a hairpin structure. Attenuation occurs at moderately low levels of Trp 1-2 hairpin

10. 1 2 3 4 Attenuation occurs at moderately low levels of Trp With regions 1& 2 in a hairpin, regions 3 & 4 can form a similar structure Attenuation occurs at moderately low levels of Trp UUUUUUUUU AUG UGA UGGUGG RNA polymerase

11. RNA polymerase dissociates after transcribing poly U stretch Attenuation occurs at moderately low levels of Trp Formation of the 3-4 hairpin, results in transcription termination Next Attenuation occurs at moderately low levels of Trp UUUUUUUUU AUG UGA UGGUGG

12. Attenuation Animation Click the button to see a faster animated sequence of steps for attenuation just showing the events without all the text.

13. Attenuation Animation AUGUGG RP

14. Attenuation Animation 12 AUGUGAUGGUGG RP

15. Attenuation Animation 12 AUGUGAUGGUGG RP

16. Attenuation Animation 12 AUGUGAUGGUGG RP 3

17. Attenuation Animation 12 AUGUGA 34 UGGUGG RP

18. AUG UGA UGGUGG 3 1 2 RP Attenuation Animation

19. 3 AUG UGA UGGUGG 1 2 Attenuation Animation RP

20. 1 2 3 4 UUU AUG UGA UGGUGG RP Attenuation Animation

21. 1 2 3 4 UUUUUUUUU AUG UGA UGGUGG RP

22. Attenuation Animation RP UUUUUUUUU AUG UGA UGGUGG

23. AUGUGG RNA polymerase Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed The following 5 slides show lack of attenuation in the near absence of Trp Click the button below to view

24. 1 2 AUGUGAUGGUGG RNA polymerase Ribosome Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed Ribosome begins translation, but stalls when it reaches 2 trp codons in leader sequence Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed

25. 12 AUGUGAUGGUGG RNA polymerase Ribosome Paused on Trp codons Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed RNA polymerase continues to transcribe the leader sequence Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed

26. RNA polymerase 12 AUGUGA 34 UGGUGG Ribosome Paused on Trp codons Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed

27. 1 UUUUUUUUU RNA polymerase 2 3 4 AUGUGAUGGUGG Ribosome Paused on Trp codons Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed Since the ribosome is stalled on region 1, region 2 & 3 are avialable to form a hairpin structure while RNA polymerase finishes transcribing region 4 Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed

28. 1 UUUUUUUUU 2 3 4 AUGUGAUGGUGG Ribosome Paused on Trp codons RNA polymerase Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed With the formation of the 2-3 hairpin, there is hairpin formed immediately upstream of the poly U stretch. This allows RNA polymerase to continue transcription of the remainder of the operon Replay Very low levels of Trp prevent attenuation allowing Trp EDCBA genes to be transcribed