1. Biochemistry 611 Nucleic Acids 8-28-07

2. Chad Wilkerson Post-doctoral fellow in Kevin Sarge’s lab Post-doctoral fellow in Kevin Sarge’s lab Dept. Biochemistry, BBSRB Building Dept. Biochemistry, BBSRB Building Lab phone 257-7349 Lab phone 257-7349 Email: dcwilk2 @ uky.edu Email: dcwilk2 @ uky.edu

3. Topics To Be Covered Isolating Isolating  Dissociation/deproteinization  Precipitation Quantitating Quantitating  UV absorption Separating Separating  Gel electrophoresis: Agarose & Polyacrylamide Analysis Analysis  DNA: Southern blot, gel shift (EMSA), DNase footprinting, ChIP, Promoter pull-down, PCR ChIP, Promoter pull-down, PCR  RNA: RT-PCR, RACE, Exon trapping, PCR-based cDNA cloning, RNase Protection, northern blot, nuclear run-off, primer extension RNase Protection, northern blot, nuclear run-off, primer extension

4. Isolation of Nucleic Acids Two Main Steps for Isolation 1) Dissociation/deproteinization detergent (e.g. SDS, Triton X-100, NP40, CHAPS) detergent (e.g. SDS, Triton X-100, NP40, CHAPS) An organic (e.g. phenol) An organic (e.g. phenol) DNA  phenol:chloroform:isoamyl alcohol (25:24:1) at pH 8.0 RNA  acidic pH (below 7) DNA will denature and partition into the organic phase Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-60) Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-60) 2) Precipitation Raising the salt concentration to at least 0.1M and adding an alcohol (67% ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous phaseRaising the salt concentration to at least 0.1M and adding an alcohol (67% ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous phase Common salts include: sodium acetate (NaAc) – samples brought to 0.3M Common salts include: sodium acetate (NaAc) – samples brought to 0.3M potassium acetate (KAc) – samples brought to 0.3M potassium acetate (KAc) – samples brought to 0.3M ammonium acetate (NH4Ac) – samples brought to 2M ammonium acetate (NH4Ac) – samples brought to 2M

5. Isolation of Nucleic Acids Things to keep in mind when isolating nucleic acids 1) The integrity of the nucleic acid low and high pH can lead to hydrolysis of nucleic acidslow and high pH can lead to hydrolysis of nucleic acids Excess pipetting or vortexing can shear DNAExcess pipetting or vortexing can shear DNA 2)Any enzyme requirements Specific salts and salt concentrations can inhibit enzymesSpecific salts and salt concentrations can inhibit enzymes EDTA can inhibit reactionsEDTA can inhibit reactions 3)Any functional requirements Some technologies require higher purification of nucleic acidsSome technologies require higher purification of nucleic acids

6. Isolation of Nucleic Acids Additional topics related to isolation of nucleic acids 1) Tissue disruption Dounce homogenizerDounce homogenizer Mortar and pestleMortar and pestle SonicationSonication 2)Cellular fractionation Examples: nuclei, mitochondria, polysomesExamples: nuclei, mitochondria, polysomes 3)Chromatographic purifications Examples: CsCl gradients, DEAE cellulose, oligo dT celluloseExamples: CsCl gradients, DEAE cellulose, oligo dT cellulose

8. Quantitating Nucleic Acids Definition of O.D. at A260 refers to the O.D. reading when the sample in question is diluted to 1.0ml of ddH20 and read in a 1cm quartz cuvette at 260nm. Nucleic Acids absorb UV light at a maximum of 260nm There is a direct relationship between the concentration of a nucleic acid and its absorption of UV light at 260nm 40 x OD260 of sample = concentration of RNA (ug/mL) 50 x OD260 of sample = concentration of DNA (ug/mL) 33 x OD260 of sample = concentration of oligonucleotide (ug/mL) 1 A260 dsDNA = 50ug 1 A260 ssDNA = 33ug 1 A260 ssRNA = 40ug

9. The relative purity of nucleic acid samples can be determined by measuring their absorption at other wavelengths. 2 main contaminates include proteins and polysaccarides which have absorption maximas at 280nm and 230nm respectively. An uncontaminated RNA sample would have a 230, 260, 280 ratio of 1:2:1 An uncontaminated DNA sample would have a ratio of 1:1.8:1 Quantitating Nucleic Acids

10. Separating Nucleic Acids Gel Electrophoresis Agarose Less analyticalLess analytical Typically used to separate nucleic acids greater than 100 bpTypically used to separate nucleic acids greater than 100 bp Concentrations range from 0.4% - 3%Concentrations range from 0.4% - 3% Buffers commonly used include TAE or TBE (non-denaturing) and MOPS-formaldehyde (denaturing)Buffers commonly used include TAE or TBE (non-denaturing) and MOPS-formaldehyde (denaturing)Polyacrylamide High resolution capacityHigh resolution capacity Concentrations range from 4% - 20%Concentrations range from 4% - 20% Buffers commonly used include TBE or TTE (Tris-taurine EDTA)Buffers commonly used include TBE or TTE (Tris-taurine EDTA) For denaturing nucleic acids urea is added to a final concentration of 7-8MFor denaturing nucleic acids urea is added to a final concentration of 7-8M

11. Separating Nucleic Acids Agarose Polyacrylamide 0.360-5 0.6 20 – 1 0.7 10 – 0.8 0.9 7 – 0.5 1.2 6 – 0.4 1.5 4 – 0.2 2.0 3 – 0.1 3.5 100 - 1000 5.0 80 - 500 8.0 60 - 400 12.0 40 - 200 20.0 10 - 100 Agarose (%) Effective Range of Separation of Linear DNA molecules (kb) Acrylamide (%) Effective Range of Separation (nucleotides)

12. Analysis of Nucleic Acids DNA Analysis Southern blotSouthern blot PCRPCR DNA:Protein Interactions Gel shift (EMSA)Gel shift (EMSA) DNase footprintingDNase footprinting Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP) Promoter pull- downPromoter pull- down RNA Analysis RT-PCRRT-PCR Race and Exon TrappingRace and Exon Trapping PCR based cDNA cloningPCR based cDNA cloning northern blotnorthern blot RNase ProtectionRNase Protection Primer extensionPrimer extension Nuclear run-offNuclear run-off

13. Southern Blot Southern Blot (named after Edward M. Southern) Commonly used to determine the molecular weight of a restriction fragment, to measure relative amounts in different samples and to locate a particular sequence of DNA within a complex mixture Basic Protocol: 1)Fragment DNA using restriction enzymes 2)Separate fragments by agarose gel electrophoresis 3)DNA fragments are denatured and transferred to a nitrocellulose membrane a nitrocellulose membrane 4)These membrane-bound fragments are assayed for their ability to hybridize with a specific labeled for their ability to hybridize with a specific labeled nucleotide sequence (probe). nucleotide sequence (probe). Probes: Range in size from small (16 mers) to very Range in size from small (16 mers) to very large (500+) DNA fragments large (500+) DNA fragments Labeled at their terminus through kinase treatment Labeled at their terminus through kinase treatment or internally through nick translation or internally through nick translation Labels can be in the form of isotopic or chromogenic Labels can be in the form of isotopic or chromogenic

14. Polymerase Chain Reaction (PCR) Invented in 1983 by Kary Mullis – Nobel Prize in Chemistry 1993Invented in 1983 by Kary Mullis – Nobel Prize in Chemistry 1993 Allows the rapid amplification of DNAAllows the rapid amplification of DNA Core components include: Template Purity, source, concentrationPurity, source, concentration genomic DNA ~ 100-250 nggenomic DNA ~ 100-250 ng plasmid DNA ~ 20 ngplasmid DNA ~ 20 ng Buffer MgCl 2 necessaryMgCl 2 necessary (0.5mM to 3.0mM  1.5mM default)(0.5mM to 3.0mM  1.5mM default)dNTP’s Final conc 200  M - too high can inhibit rxnFinal conc 200  M - too high can inhibit rxnPolymerase Error rate and Conditions (next slide)Error rate and Conditions (next slide)Primer(s) Size (typically 18-30 nt)Size (typically 18-30 nt) G+C content (40-60%)G+C content (40-60%) Minimize secondary structure (hairpins)Minimize secondary structure (hairpins) Concentration (0.1 and 0.5 mMConcentration (0.1 and 0.5 mM) Critical Parameter : Annealing Temperature About 5-7°C below Tm of primer pairs About 5-7°C below Tm of primer pairs Annealing Time Rule of thumb is 1kb per minute Rule of thumb is 1kb per minute Primer Design Discussed later Discussed later

15. Taq Polymerase Isolated from Thermus aquaticus in 1976 Isolated from Thermus aquaticus in 1976 Catalyze template-directed synthesis of DNA from nucleotide triphosphates Catalyze template-directed synthesis of DNA from nucleotide triphosphates Requires a primer having a free 3' hydroxyl is required to initiate synthesis Requires a primer having a free 3' hydroxyl is required to initiate synthesis Magnesium ion is necessary Magnesium ion is necessary Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C) Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C) Incorporates approx. 125,000 nucleotides before making an error Incorporates approx. 125,000 nucleotides before making an error Other themostable polymerases Pfu: Pyrococcus furiosus Lowest error rate of known thermophilic polymersases Lowest error rate of known thermophilic polymersases Incorporates approx. 767,000 nucleotides before making an error Incorporates approx. 767,000 nucleotides before making an error Vent (or Ttl): Thermococcus litoralis The most heat stable of all (halflife of 7 h at 95°C) The most heat stable of all (halflife of 7 h at 95°C) Tgo: Thermus aquaticus Highly processive = copies fast Highly processive = copies fast Tth: Thermus thermophilus Copies long sequences Copies long sequences LOTS OF POLYMERASES

16. Primer Design: Size (typically 18-30 nt) Size (typically 18-30 nt) G+C content (40-60%) G+C content (40-60%) Minimize secondary structure → Minimize secondary structure → Concentration (0.1 and 0.5 mM Concentration (0.1 and 0.5 mM) Avoid runs of 3 or more G or C at the 3' end Avoid a T at the 3' end Avoid a T at the 3' end Avoid mismatches at the 3' end Avoid mismatches at the 3' end Avoid complementary sequences within a primer and between primers Avoid complementary sequences within a primer and between primers Melting Temperature (Tm): Tm by definition is the temperature in which ½ the molecules in a hybridizing pair are single stranded Calculating the Tm: 1)2 + 4 rule 2)Software: Primer Premiere 3)Online: IDTDNA.com 4)Trial and error

17. Primer Design: Calculating the Tm using the 2+4 rule: TACCTAGGTTGACCATCTACTAA TACCTAGGTTGACCATCTACTAA = 9 G+C TACCTAGGTTGACCATCTACTAA = 14 A+T Tm = 2°C x (14) + 4°C x (9) Tm = 28 °C + 36 °C = 64 °C 62  65  68 

18. Types of PCR: Real-time PCR More quantitative than conventional PCRMore quantitative than conventional PCR Measurements are taken early in reaction rather than at the end point as inMeasurements are taken early in reaction rather than at the end point as in conventional PCR conventional PCRRT-PCR Makes cDNA from RNAMakes cDNA from RNANested-PCR Consists on two consecutive PCR reactionsConsists on two consecutive PCR reactions The amplified product from the first reaction acts as template DNA for the secondThe amplified product from the first reaction acts as template DNA for the second ** See Supplement online** See Supplement online Hot-start PCR Reaction starts at 98°C without a slow warm upReaction starts at 98°C without a slow warm up Primers do not have the chance to anneal at temperatures lower than the TmPrimers do not have the chance to anneal at temperatures lower than the Tm Amplified products tend to be cleanerAmplified products tend to be cleaner Touchdown PCR PCR cycling begins at annealing temp above the expected annealing tempPCR cycling begins at annealing temp above the expected annealing temp The annealing temp is decreased every 1-3 cycles until it reaches the expected annealing tempThe annealing temp is decreased every 1-3 cycles until it reaches the expected annealing temp

19. Real-Time PCR More than you would ever want to know: http://www.dorak.info/genetics/realtime.html Based on detecting and quantifying the fluorescence of a reporter Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production at each PCR cycle (in real time) as opposed to the endpoint detection Three general methods for the quantitative detection: 1.DNA-binding agents (SYBR Green) 2.Hydrolysis probes (TaqMan, Beacons, Scorpions) – utilizes exonuclease activity of polymerase! 3.Hybridization probes (Light Cycler)

20. The fluorescent signal increase in direct proportion to the amount of PCR product in a reaction. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template.

21. Real-time PCR advantages not influenced by non-specific amplification amplification can be monitored real-time no post-PCR processing of products (no gel analysis, low contamination risk, less loss) rapid cycling (30 minutes to 2 hours) range of detection is as low as a 2-fold change up to 1010-fold requirement of 1000-fold less RNA than conventional assays confirmation of specific amplification by melting point analysis not much more expensive than conventional PCR (except equipment cost) Different dilutions of the same template # PCR CYCLES Increasing Fluorscence →

22. What are the more common techniques used to study protein:DNA interactions? Gel shift (EMSA)Gel shift (EMSA) DNase footprintingDNase footprinting Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP) Promoter pull-downPromoter pull-down

23. Gel Shift or Electrophoretic Mobility Shift Assay (EMSA) Assay provides a simple and rapid method for detecting in vitro interactions between DNA and proteinsAssay provides a simple and rapid method for detecting in vitro interactions between DNA and proteins Commonly used to study sequence-specific DNA-binding proteins such as transcription factorsCommonly used to study sequence-specific DNA-binding proteins such as transcription factors The assay is based on the observation that complexes of protein and DNA migrate through a non-denaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded oligonucleotidesThe assay is based on the observation that complexes of protein and DNA migrate through a non-denaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded oligonucleotides

24. Excess unlabeled oligonucleotide Antibody to DB Protein DB Protein Labeled oligonucleotide Binding Reaction: Protein/Extract Labeled Probe Buffer Antibody ** Competitor DNA **

25. DNase Footprinting The method of choice for identifying sequence specific binding of proteins to DNA The method of choice for identifying sequence specific binding of proteins to DNA Developed in 1978 by Galas and Schmitz Developed in 1978 by Galas and Schmitz Look for papers on Biochemistry website: Galas_and_Schmitz_Footprinting.pdf Kang_Footprinting.pdf

26. Chromatin Immunoprecipitation Assay (ChIP) Chromatin immunoprecipitation (ChIP) is a powerful in vivo method to show interaction of proteins associated with specific regions of the genome. ChIP allows you to detect recruitment of a particular transcription factor to a promoter region, analyze the interaction of any protein with any DNA sequence in vivo. Fragments of DNA purified by ChIP can be used for cloning (i.e. Farnham paper) More information can be found at: http://www.upstate.com/chiphttp://www.upstate.com/chip and Farnham_ChIP_Cloning.pdf (Biochemistry website)

27. Protein bound DNA within nuclei (only nuclei shown) Crosslink DNA+Proteins Isolate and lyse nuclei Shear DNA – sonication most common method Add antibody against protein of interest and IP protein+DNA complex Wash extensively with various salt buffers and release antibody from protein+DNA complexes with elution buffer (SDS+NaHCO3) Reverse crosslink by incubating at 67°C with 200mM NaCl Purify DNA Purified DNA ready to be assayed (i.e. PCR)

28. Promoter Pull-down Technique to identify proteins that bind to a specific DNA sequence

29. RNA Analysis RT-PCRRT-PCR PCR based cDNA cloningPCR based cDNA cloning northern blotnorthern blot RNase ProtectionRNase Protection Primer extensionPrimer extension Nuclear run-offNuclear run-off Race and Exon TrappingRace and Exon Trapping

30. Reverse Transcriptase-PCR (RT-PCR) Technique used to make cDNA from RNA Template: RNA Two consecutive reactions Reaction #1  Reverse transcription of RNA into cDNA (RNA:DNA hybrid)Reaction #1  Reverse transcription of RNA into cDNA (RNA:DNA hybrid) Reaction #2  Standard PCR reaction to make double stranded cDNAReaction #2  Standard PCR reaction to make double stranded cDNA Most Common Uses: Looking at gene expression (mRNA levels)Looking at gene expression (mRNA levels) Assaying viral systemsAssaying viral systems

31. RT-PCR Basic Reaction Mixture: RNAdNTPsPrimers 1x Buffer Reverse Transcriptase RNase Inhibitor Thermophilic Polymerase

32. PCR based cDNA Cloning Commonly used to make a cDNA library from mRNA

33. Northern Blots Similar to southern blots in that it involves the separation of RNA species on agarose gels and their transfer to nitrocellulose. Unlike Southern blots, Northern blots are separated on a denaturing formaldehyde-agarose gel and gels are not treated with NaOH prior to transferring to nitrocellulose.

34. Nuclease Protection Assay (NPA) The basis method involves: 1)Hybridize in solution a single-stranded antisense probe(s) to an RNA sample 2)After hybridization, any unhybridized probe and sample RNA are removed by digestion with nucleases 3)The nucleases are inactivated and the remaining probe:target hybrids are precipitated. 4)These products are separated on a denaturing polyacrylamide gel and are visualized Nuclease protection assays (NPAs) include both ribonuclease protection assays (RPAs) and S1 nuclease assays These two assays are an extremely sensitive method for the detection, quantification and mapping of specific RNAs in a complex mixture of total cellular RNA. There are several advantages to this technique including (1) multiple mRNAs can be assayed in a single RNA preparation (2) the length of each gene fragment is unique allowing multiple probes to be synthesized together and hybridized to a single target sample (3) highly specific and sensitive assay allowing the detection of sub-picograms quantities of specific mRNA Detailed Information can be found at: http://www.ambion.com/techlib/basics/npa/

35. RNase Protection Assay What in the world would you use this for?? Example: You knockout a transcription factor in a mouse. You want to know if the lack of this transcription factor affects the transcription of gene X, gene Y, and gene Z. You can probe for the presence of the mRNA for each of the genes in question using RNase Protection Assays

36. Primer Extension Primer extension is used to map the 5' ends of DNA or RNA fragments. For more information see: http://www.promega.com/tbs/tb113/tb113.pdf Basic Protocol: 1. A specific oligonucleotide primer is labeled, usually at its 5' end, with 32 P its 5' end, with 32 P 2. The labeled primer is annealed to a position downstream of that 5' end of the template downstream of that 5' end of the template 3. The primer is extended with reverse transcriptase (making a fragment that ends at the 5' end of the template). (making a fragment that ends at the 5' end of the template). DNA polymerase can also be used with DNA templates. DNA polymerase can also be used with DNA templates. 4. The newly synthesized labeled fragment is analyzed by gel electrophoresis electrophoresis What in the world would you use this for?? 1.Can identify the transcription start site 2.RPA can tell you if a mRNA species is present but primer extension can provide sequence size

37. Nuclear Run-off Assays Sensitive method for measuring rates of expression (transcription) of a specific gene Sensitive method for measuring rates of expression (transcription) of a specific gene Based on incorporation of radiolabeled NTPs into elogating mRNAs and counting the Based on incorporation of radiolabeled NTPs into elogating mRNAs and counting the radioactivity radioactivity General Protocol: 1)Isolate nuclei 2)Incubate with 32 P-UTP 3)Treat with DNase 4)Hybridize to denatured-immobilized cDNA corresponding to the mRNA 5)Treat with RNase 6)Count radioactivity Biochemistry Website: Baldassare_NRO.pdf Li_Chaikof_NRO.pdf

38. Nuclear Runoff Assay Assaying the effect of SB203580 (imidazole) on IL-1 (cytokine) gene transcription in RAW264.7 cells Raw264.7 cells were stimulated with LPS (endotoxin from E. coli) in the presence or absence of SB203580 at the indicated concentrations and analyzed by nuclear run-on analysis Equal cpm of radiolabeled run-on RNA were used to probe individual nylon strips carrying an excess of the indicated denatured cDNA probes. The Bluescript plasmid (BS) was included as a background control because the murine IL-1 and IL-1ß, and TNF- cDNAs were all subcloned into this plasmid. The blots were exposed for 2–3 wk, and the resultant films were scanned and digitized on a PhosphorImager. Shown are representative data from four separate similar experiments. Equal cpm of radiolabeled run-on RNA were used to probe individual nylon strips carrying an excess of the indicated denatured cDNA probes. The Bluescript plasmid (BS) was included as a background control because the murine IL-1 and IL-1ß, and TNF- cDNAs were all subcloned into this plasmid. The blots were exposed for 2–3 wk, and the resultant films were scanned and digitized on a PhosphorImager. Shown are representative data from four separate similar experiments. Conclusion: the imidazole does inhibit transcription of the cytokine IL-1  Baldassare et al., J. Immunol. 1999 May 1;162(9):5367-73 Endotoxin (stimulates Tc) Imidazole

39. Rapid Amplification of cDNA Ends (RACE) RACE is a procedure for amplification of nucleic acid sequences from a messenger RNA template between a defined internal site and unknown sequences at either the 3' or the 5' -end of the mRNA 2 Types of RACE: 5′ RACE and 3′ RACE Detailed Information can be found at: http://www.invitrogen.com/content/sfs/manuals/5prime_race_man.pdf Why would you use RACE? Amplify and characterize regions of unknown sequences -or- amplification of rare messages for which little sequence information is known

40. 5′ RACE 3′ RACE

41. Exon Trapping Exon Trapping is used to isolate the transcribed sequences (exons) of a gene from genomic DNA The exon trapping methods and vector were developed Alan Buckler et al. Basic Protocol: 1)Random segments of chromosomal DNA are inserted into an intron present within a mammalian expression vector 2)The cloned DNA is transfected into COS-7 cells 3)Amplified exons are spliced such that the vector and genomic exons are paired 4)Cytoplasmic mRNA is harvested and screened by PCR amplification for the acquisition of an exon from the genomic fragment  the presence of two BstX I restriction sites flanking the MCS helps minimize the recovery of vector-vector splicing or cryptic splicing Publication: Buckler_Orig_Paper.pdf (Biochemistry website) More information can be found at: http://www.invitrogen.com/content/sfs/manuals/18449017.pdf and Online Supplement

42. AG GU AGU A G NCAG G exon intron exon intron Splicing  consensus sequences 5 splice site splice donor site 3 splice site splice acceptor site Genomic DNA containing an exon flanked by introns AG GU AGU A G NCAG G exon intron exon intron exon DS AS DS AG G exon MCS mammalian expression vector

43. Microarray Technology A technique scientist use to allow them to easily detect and measure the expression of thousands of genes at one time. Involves a DNA glass slide that is fixed with tiny amounts of a large number of single- stranded DNA fragments. Uses: Studying differences in gene expression amongst a variety of genes in one organism Studying differences in gene expression amongst a variety of genes in one organism Studying differences in gene expression between genetically similar organisms Studying differences in gene expression between genetically similar organisms Compare cancerous tissue with noncancerous tissue Compare cancerous tissue with noncancerous tissue General Protocol: 1) Hybridization: Make labeled cDNA from mRNA and apply to the DNA chip 2) Rinse off excess cDNA and scan for fluorescence 3) Each fluorescent spot will indicate that the cDNA strand was complimentary to the strand on the DNA chip on the DNA chip 4) Ratio of fluorescence emission indicates relative abundance of each mRNA Interesting articles on the Biochemistry website: EricLander_Microarray.pdfBrown_Botstein_Microarray.pdf

44. END