1. Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence

2. Lynagh’s Two Keys Tavern Two Keys Tavern Consequences of Cutthroat Rivalry

3. Prisoner’s Dilemma Criminal 1 Criminal 2 Squeal Clam Up Both Serve 1 Year Both Serve 5 Years #2 Serves 10 Years #1 Goes Free #1 Serves 10 Years #2 Goes Free

4. What Price a Dollar? n $1.00 will be auctioned off n Opening bid is 10¢ n Bids increase in 10¢ increments n Highest bidder wins $1.00 n Top two bidders must pay auctioneer

5. Three Stooges n Larry, Curley and Moe are in a 3-way duel and agree to take turns shooting each other in that order n Accuracy statistics: –Larry hits intended target 20% of the time –Curley hits intended target 80% of the time –Moe hits intended target 100% of the time n What should Larry do?

6. The Playbook: What will they run next?

7. Complex Rivalry: Where to move?

8. Firm 1 Actions Firm 2 Actions Competitive Interaction Competitive Outcomes Industry Characteristics Organizational Characteristics

9. Competitive Dynamics n Observe competitive moves n Organize competitive moves –Action/response pairs –Action repertoires (year-end tallies) –Competitive attacks/sequences n Measurement/Analysis of Characteristics –Four key action pattern characteristics that improve: Market share Stock price Profitability

10. Strategy as Action n Externally-directed, observable competitive moves carried out to improve relative competitive position: Pricing Marketing Products Service Capacity Signals Other Airlines Telecom Brewing PCs Software Mutual Funds 41 Industries Generic Actions: Studies: Actions symbolically represented as these

11. Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 Action-Reaction “Pairs” time Action Response n n Profits n n Growth n n Mkt. Share

12. Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 Action-Reaction “Pairs” time n Type n Implementation Requirement n Radicality n Irreversibility n n Likelihood n n Speed (delay) n n Matching

13. Prior Studies: Action “Repertoires” time n Profits n Growth n Mkt. Share Year-End Tallies Action Repertoire Company 1 Company 2

14. Prior Studies: Action “Repertoires” time n Profits n Growth n Mkt. Share Year-End Tallies n Total Actions n Complexity Company 1 Company 2

15. a b c d e f g h 8765432187654321 Sequential Competitive Interaction ? This Sequence: Black: Knight b4 White: Pawn c3 Black: Bishop g4 White: Queen b5 Black: Pawn c5 Named Sequences: Epaulette’s Mate Sicilian Defense

16. Sequence Applications... LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;

17. Sequences in Competitive Interaction n Ordered sample of things –Temporal orderliness among elements n Logically unified sequence –Succession of market-based decisions n Patterns in stream of behaviors n Coordinated series of actions n Actions in a sequential strategic thrust

18. Action Sequence 1 Action Sequence 2 Competitive Attack: Sequence of Actions time n n Profits n n Growth n n Mkt. Share Competitive Attack

19. MKT PRICEMKTPRICE SVCPROD Rival Firm (a)(a’) Time Focal Firm n Avg. Attack Volume (a + a’) –No. of Actions per Attack n Avg. Attack Duration (a + a’) –No. days firm sustains attack

20. MKT PRICEMKTPRODPRICE Time MKT PRICESIGPRODPRICE Time Period 1 Time Period 2 MKT n Attack Unpredictability –Resemblance of two attack sequences

21. Focal Firm’s Stock Price and/or Market Share Gain Focal Firm’s Competitive Attack Attack Volume Attack Duration Attack Complexity Attack Unpredictability MKT PRICEMKTPRODMKTCAPSIG PRODMKT Attack a Attack a’

22. Group Exercise: Bud vs. Miller n Total Actions –Count of total actions n Average Response Time –Avg. number of time units between last competitive move and first competitive response n Repertoire Complexity –Extent to which repertoire is skewed vs. balanced n Attack Unpredictability –Lack of discernable action combinations or repetition

23. Response: Less Likely Slower Action Characteristics Implementation Req. Irreversibility Radicality Action/Response Pairs Better Profitability for Attacker

24. Market Share Gain Action Repertoire Characteristics More Actions Complexity Faster Avg. Response Speed Competitive Repertoire and Market Share Gain

25. Competitive Attack and Market Share Gain Market Share Gain Competitive Attack Characteristics Attack Volume Attack Duration

26. Competitive Attack and Market Share Gain Market Share Gain SimpleComplex Extent of Attack Complexity

27. Competitive Attack and Market Share Gain Market Share Gain Predictable Unpredictable Extent of Attack Unpredictability

28. Results: Attack Intensity Stock Price Sporadic, Infrequent Intense, Sustained Number of Actions within Sustained Attack per Unit Time Results reversed for relationship between focal firm’s attack and rival’s stock price.

29. Results: Attack Complexity SimpleComplex Extent to which Focal Firm’s Attacks Consist of Actions of Many Types Stock Price

30. Post Hoc: Attack Unpredictability Rival’s Stock Price Predicable, Inertia Unpredictable, Change Extent of Change in Focal Firm’s Sequence of Actions

31. Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks Miller Bud

32. Competitive Aggressiveness Performance Market Share Gains Profitability Too much of a good thing? Lynagh’s vs. Two Keys

33. Implications for CI: Predict Future Behavior of Rivals Rivals’ prior behavior n Patterns n Tendencies n Type & order of moves n Proactiveness n Reactiveness Drivers of Behavior n Management orientation n Decision-making n Financial constraints n Industry characteristics

34. Implications for CI: Monitor Your Own Behavior n Objective measures of competitive behavior n Safeguard against complacency, predictability, simplicity n Keep rivals off balance / disruption n Identify factors that facilitate aggressiveness n What combinations of moves are effective? …which are ineffective? …smoke signals?

35. Conclusions and Implications n Managerial Implications –Incorporate dynamic analysis of competitive moves into competitive intelligence program –Assists managers to make inform choices about the requisite level of competitive behavior –Use stock returns as an important decision-making tool and as a messenger