1. Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III - Variation Test 2 Monogenic and Complex Diseases Finding ‘Disease’ Genes Pharmacogenomics Test 3 Your Presentations Happy New Year! Molecular Genetics The Human Genome: Biology and Medicine http://priede.bf.lu.lv/http://priede.bf.lu.lv/ Studiju materiāli / MolekularasBioloģijas / MolGen / EN

2. The Human Genome 21 000

3. MUTATIONS Rare variants Polymorphisms GENETIC VARIATIONS: alternatives of genomic DNA sequence (alleles) that are present in individual (-s) or population (-s) Minor allele frequency > 1% Minor allele frequency < 1% “Bad”: cause genetic disease Polymorphisms (common variation): majority – neutral The rest: slightly “bad” (predispose to disease) slightly “good” (protect from disease) both slightly bad and good (predispose to and protect from certain conditions)

4. Types of genetic variations Inversions Duplications Translocations Transposon insertions Variations exceeding 1000bp - STRUCTURAL VARIATIONS less than 3 million bp - submicroscopic; larger– microscopic InDels and duplications are called CNVs (copy number variations) CCTAGTTGACTGATCGCGGGATTCACACACATGG CCTGGTTGAC..ATCGCGGGATTCACACACACACATGG Single (point) base changes two alleles SNPs Single Nucleotide Polymorphisms; > 10, 000, 000 InDels (insertions/deletions) two alleles > 1,000,000 SSR – short sequence repeats (VNTR - variable number tandem repeats) many alleles microsatellites (1-5) minisatellites (6-100) … > 1,000,000

5. Each person is unique Molecular Biology of the Cell, 4 th Edition

6. At the same time, humans “are essentially identical twins” 10 000 6 000 000 000 < 3000 generations RAO(R) – Recent African Origin (and Replacement)

7. Genetic diversity is highest in Africans Population codes: AF, African- American; AS, Asian; CA, Caucasian; and HL, Hispanic- Latino.

8. Genetic diversity is highest in Africans

9. Use of common variations in genetic association studies CD /CV (Common Disease/Common Variants) hypothesis: Common diseases are underlied by a few common variants CD/RV (Common Disease /Rare Variants) – diseases are driven by many rare alleles

10. SNP map Genes SNPs A map of human genome sequence variation... –The International SNP Map Working Group. Nature (2001) 409, 928-933. Features of the map: –1.42 million SNPs –average density 1 SNP every 1.9 kilobases –60 000 SNPs fall within exons –85% of exons are within 5 kb of the nearest SNP

11. Good properties Many 90% Simplebinary Evenrelatively Stableevolutionary MARKERS Properties of SNPs from a distinct point of view Other SNP properties ~ 0.1% affect protein function -the same number might affect gene expression Distribution is non-uniform –genome-wide (0.1% - 10%) –between chromosomes (autosomes > X > Y) –more in non-coding than coding regions –in coding sequences silent substitutions> missense –2/3 are transitions (metC deamination in CpGs) Cosmopolitan / Population-specific Bad property - some SNPs (alleles) increase the risk of disease

12. Analysis of some SNPs can capture effects of other SNPs MARKERS This is possible owing to Linkage Disequilibrium (LD)

13. There are many haplotypes in the absence of LD Gene SNPs LD AC AA AC AA C C T T GC GA GC GA C C T T AAT GCC ACC GAT There is a limited diversity of haplotypes if LD is present LD - Linkage Disequilibrium – non-random association among alleles at two or more loci in POPULATION (or a measure of co-segregation of alleles in population) Haplotype – combination of alleles on a chromosome (usually used with respect to a small region)

14. There is a limited diversity of haplotypes when LD exists

15. The strength of LD varies and can change P A and P B - allele frequencies P AB - haplotype frequencies D = P AB - P A x P B D’= D/D Max A A C T G G C T 50 % 0 % A A C T G G C T 40 % 10 % A A C T G G C T 25 % T C All SNP alleles in this example have frequency = 50 % A G D = 0.25 D’= 1 Complete LD D = 0.15 D’= 0.6 Partial LD D = 0 D’= 0 No LD AaAa BbBb

16. Processes shaping genetic variation and LD GENETIC mutagenesis recombination gene conversion DEMOGRAPHIC population age genetic drift population dinamics –migration –bottlenecks … NATURAL SELECTION

17. (i) Genetic processes: recombination

18. LD, recombination, and age of population Recombinant DNA, 3rd Edition

19. N Engl J Med 2002;347:1512-1520. Genomic Medicine — A Primer. Example of origin and decay of LD

20. (ii) Demographic processes: genetic drift and “founder” mutations Recombinant DNA, 3rd Edition

21. (ii) Demographic processes: “bottleneck” effect Raven & Johnson (2004) Biology. Fig. 21.6

22. (iii) Natural Selection: hitchhiking

23. LD islands or recombination deserts Recombination rates vary by more than an order of magnitude across the genome

24. Human genome is made up of haplotype blocks

25. Haplotype map (HapMap) project – finished in 2005

26. ‘tag’ SNP MARKERS The practical aim of the HapMap project If haplotypes are known, all common variation of a region can be determined through genotyping just a few tag SNPs

27. SNP genotyping principles Nature Reviews Genetics (2001) 2, 930 -942. Genotype – the genetic constitution of an individual Genotyping – the process of allele detection

28. Structural variations (microscopic) in the human genome INVERSION TRANSLOCATION NATURE REVIEWS | GENETICS VOLUME 7 | FEBRUARY 2006 | 87

29. CNV Structural variations (submicroscopic) in the human genome

30. Copy-number variations (CNV) NATURE REVIEWS | GENETICS VOLUME 7 | FEBRUARY 2006 | 87

31. Possible influence of structural variants Human Molecular Genetics, 2006, Vol. 15, Review Issue 1 R59

32. CNV map NATURE| Vol 444|23 November 2006; pp 444-454 ~1500 CNVs 360Mb 12% of genome

33. http://www.nature.com/nature/focus/1000genomes/

34. Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III - Variation Test 2 Monogenic and Complex Diseases Finding ‘Disease’ Genes Pharmacogenomics Test 3 Your Presentations Happy New Year! Molecular Genetics The Human Genome: Biology and Medicine http://priede.bf.lu.lv/http://priede.bf.lu.lv/ Studiju materiāli / MolekularasBioloģijas / MolGen / EN