1. In Vivo assay for RNA-protein interactions Dana M. Schneider Loren Williams lab

2. Outline  The Ribosome  Yeast three hybrid assay for RNA-protein interactions  Construct vectors PCR amplify insert Restriction digest plasmids and insert Ligate vector and insert Transform ligation into E. coli Colony PCR to screen for inserts Sequence confirmation of inserts  Transform plasmids into yeast  Colony lift assay (qualitative)  Beta-galactosidase assay (quantitative)

3. The Ribosome: Protein and RNA Large Subuntit (LSU) ~34 rProteins 23S rRNA 5S rRNA Small Subuntit (SSU) ~ 22 rProteins 16S rRNA Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) Science 289, 905-920. Selmer, M., Dunham, C. M., Murphy, F. V. t., Weixlbaumer, A., Petry, S., Kelley, A. C., Weir, J. R., and Ramakrishnan, V. (2006) Science 313, 1935-1942. Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels, H., Franceschi, F., and Yonath, A. (2001) Cell 107, 679-688.

4. Deconstruction of the Ribosome Do rRNA fragments interact with rProteins as in the fully assembled ribosome? L2 L15 L4 L22 L3 a-rRNA

5. Methods to detect and characterize RNA-protein interactions  Electrophoretic mobility shift assay – in vitro  Pull-down assay – in vitro  RNase protection assay – in vitro  Yeast three-hybrid assay – in vivo in vitro methods  pro: know all constituents  con: may not have all necessary constituents in vivo methods  pro: don’t know all constituents  con: may have all necessary constituents

6. Activation Domain DNA Binding Protein DNA Binding Site Gene “High-jacking” transcription regulation Yeast in vivo Phenotype chromosome RNA-Protein interaction of interest

7. Protein Activation Domain Hybrid 3 DNA Binding Protein MS2 RNA- Binding Protein Hybrid 1 DNA Binding Site Reporter Gene LacZ MS2 RNA-X Hybrid 2 Yeast Three Hybrid System to identify RNA-protein interactions Yeast in vivo chromosome How do we get yeast to make the RNA and protein hybrids?

8. Protein Activation Domain Hybrid 3 DNA Binding Protein MS2 RNA- Binding Protein Hybrid 1 DNA Binding Site Reporter Gene LacZ MS2 RNA-X Hybrid 2 Yeast in vivo chromosome MS2 aPTC Activation DomainrProtein Transform into yeast Recombinant Plasmid How do we make recombinant plasmids? How do they work?

9. Hybrid gene expression vectors 1.Cloning site to insert gene of interest and create hybrid gene 2.Yeast promoter to express hybrid gene 3.Yeast selective marker 4.Yeast origin of replication 5.E. coli selective marker 6.E. coli origin of replication How do we clone in the gene of interest?

10. Recombinant DNA technology 1.Digest plasmid and gene of interest with specific restriction enzymes - “sticky end” overhangs 2.Dephosphorylate linearized plasmid 3.Ligate vector and insert 4.Transform ligation into E. coli 5.Confirm insert with PCR and sequence analysis http://163.16.28.248/bio/activelearner/14/ch14summary.html How do we get the gene of interest with the necessary restriction sites?

11. PCR amplify gene of interest genomic DNA target gene forward primer reverse primer restriction sequence PCR

12. Primer Design Primer sequence complementary to beginning and end of target gene specifically should have no or low sequence similarity to other DNA approximately 20 nt long Tm approximately 60-65°C Restriction sequence must be absent in target sequence must match restriction sites used to digest plasmid forward primer restriction sequence reverse primer restriction sequence

13. Recombinant DNA technology Digest plasmid and gene of interest with specific restriction enzymes - “sticky end” overhangs Dephosphorylate linearized plasmid Ligate vector and insert 4. Transform ligation into E. coli 5. Confirm insert with PCR and sequence analysis http://163.16.28.248/bio/activelearner/14/ch14summary.html

14. Transformation into E. coli http://www.odec.ca/projects/2006/sidh6h2/bg.html ampicillin

15. Colony PCR to confirm insert forward primer reverse primer colony PCR transformation plate “patch” plate Extract plasmids and send for sequencing

16. Sequence analysis of insert - chromatogram GOOD! BAD!

17. Sequence analysis of insert - alignment AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC CGCG AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC ATGAC TGAC- CCGA GA - G CGCG GOOD! BAD! maybe OK

18. Protein Activation Domain Hybrid 3 DNA Binding Protein MS2 RNA- Binding Protein Hybrid 1 DNA Binding Site Reporter Gene LacZ MS2 RNA-X Hybrid 2 Yeast in vivo chromosome MS2 aPTC Activation DomainrProtein Transform into yeast Recombinant Plasmid Recombinant plasmids for the yeast three- hybrid analysis

19. Co-transformation both plasmids into yeast  Yeast strain is mutant:  ΔLEU2, ΔADE2, ΔURA3, ΔTRP1, ΔHIS3  Selective plates lack leucine and adenine http://2011.igem.org/Team:WashU/Notebook/Transformation

20. Yeast three hybrid assay for RNA-protein interactions  Construct vectors  PCR amplify insert  Restriction digest plasmids and insert  Ligate vector and insert  Transform ligation into E. coli  Colony PCR to screen for inserts  Sequence confirmation of inserts  Transform plasmids into yeast  Colony lift assay (qualitative)  Beta-galactosidase assay (quantitative)

21. L4 Activation Domain DNA Binding Protein MS2 Coat Protein DNA Binding Site LacZ Yeast 3 Hybrid Experiment Yeast in vivo MS2 aPTC chromosome CM-AL = Media with all nutrients EXCEPT adenine and leucine MS2 aPTC Activation DomainL4

22. Colony lift assay  “Lift” colonies onto sterile filter paper  Add X-gal  galactose linked to a substituted indole.  turns blue when cleaved by β-galactosidase (LacZ)  Blue spots = positive RNA-protein interaction  Qualitative only (5-bromo-4-chloro-indolyl-β-D-galactopyranoside)

23. Quantitative β-galactosidase Assay  Grow replicates in 96-well plates  Add ONPG (ortho-Nitrophenyl-β-galactoside)  colorimetric and spectrophotometric  galactose linked to ortho-nitrophenol  Turns yellow and has O.D. at 420 nm wavelength when cleaved by β-galactosidase  OD 420nm = “strength” of RNA-protein interaction 0.041 0.3510.5580.6330.3410.6560.2930.150.6090.042 0.041 0.3620.5530.6410.360.6690.2940.1520.6170.0430.041 0.0420.0490.3480.550.6470.3530.6650.2860.1420.5950.0430.042 0.3480.5120.650.3430.6630.2930.1540.6010.043 0.0420.0430.3150.520.630.3290.6550.2980.1490.5940.0430.042 0.2990.4910.6210.3530.6510.2660.1420.5610.042 0.0440.2970.480.6380.3530.6470.2430.1250.510.0440.041 0.040.0430.270.4760.6210.3080.6310.170.0970.4030.0420.041

24. In vivo interactions of a-rRNA γ and DIII with L2, L3, L4, L15, L22, L23, and L34 RNA Hybrid What are your conclusions from this graph?

25. Thanks!