Presentation is loading. Please wait.

Presentation is loading. Please wait.

SnRNP (snRNA) nello spliceosoma. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006.

Similar presentations


Presentation on theme: "SnRNP (snRNA) nello spliceosoma. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."— Presentation transcript:

1 snRNP (snRNA) nello spliceosoma

2 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

3

4 Intermedi di splicing: complessi E, A

5 Intermedi di splicing: complessi B

6 Intermedi di splicing: complessi C

7 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright © 2005

8 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

9

10

11

12 …CUGCUGAGGCGAGGUAGAUACA CUCCUCCAUAGGUGGUGCUGGC......UACUGCUGAGGCGAGGUGGUGCUGGGCAUC.. introne esone

13 Splicing nucleare Splicing di introni di tipo II Splicing di introni di tipo I Splicing di tRNA di lievito spliceosoma nucleasi e ligasi autosplicing trans- esterificazioni meccanismo simile Tipi di splicing

14 RNA catalitico RNAsi P Viroidi e virusoidi Introni di gruppo I e II

15 G G C G N N N N A N N N N N A A U G C A U N GN N N G C N C A loop 1 loop 2 loop 3 G G C CU A G U G A U GC C A GC G 5'ppp 3' OH ribozima La testa di martello (hammerhead)

16 Ribozima hammerhead

17 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

18 Struttura dellintrone dellrRNA di Tetrahymena

19 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

20

21

22 Trans-splicing in C. elegans

23 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

24 Splicing alternativo

25 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

26

27 Regolazione dello splicing

28 Editing

29 Editing dellmRNA per la Apolipoproteina B umana

30 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

31 Editing dellmRNA per la subunità B di GluR

32 Editing inserzionale in Tripanosoma

33 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

34 Editing inserzionale mediante RNA guida

35 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

36


Download ppt "SnRNP (snRNA) nello spliceosoma. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."

Similar presentations


Ads by Google