Presentation is loading. Please wait.

Presentation is loading. Please wait.

Lo splicing dellRNA definizione importanza predizione Ing Francesco Piva Gruppo di biologia computazionale e molecolare Dipartimento di Biochimica, Biologia.

Similar presentations


Presentation on theme: "Lo splicing dellRNA definizione importanza predizione Ing Francesco Piva Gruppo di biologia computazionale e molecolare Dipartimento di Biochimica, Biologia."— Presentation transcript:

1 Lo splicing dellRNA definizione importanza predizione Ing Francesco Piva Gruppo di biologia computazionale e molecolare Dipartimento di Biochimica, Biologia e Genetica Università Politecnica delle Marche Edificio Scienze 3, Brecce Bianche, Ancona

2 These are synonymous words, are we sure ?... Ala Val Arg... GCA C G T GTA C G T CGA C G T AGA G GCAGTACGA GCAGTACGC GCAGTACGG GCAGTACGT GCAGTAAGA GCAGTAAGG GCAGTCCGA GCAGTCCGC GCAGTCCGG GCAGTCCGT GCAGTCAGA GCAGTCAGG GCAGTGCGA GCAGTGCGC GCAGTGCGG GCAGTGCGT GCAGTGAGA GCAGTGAGG GCAGTTCGA GCAGTTCGC GCAGTTCGG GCAGTTCGT GCAGTTAGA GCAGTTAGG GCCGTACGA GCCGTACGC GCCGTACGG GCCGTACGT GCCGTAAGA GCCGTAAGG GCCGTCCGA GCCGTCCGC GCCGTCCGG GCCGTCCGT GCCGTCAGA GCCGTCAGG GCCGTGCGA GCCGTGCGC GCCGTGCGG GCCGTGCGT GCCGTGAGA GCCGTGAGG GCCGTTCGA GCCGTTCGC GCCGTTCGG GCCGTTCGT GCCGTTAGA GCCGTTAGG GCGGTACGA GCGGTACGC GCGGTACGG GCGGTACGT GCGGTAAGA GCGGTAAGG GCGGTCCGA GCGGTCCGC GCGGTCCGG GCGGTCCGT GCGGTCAGA GCGGTCAGG GCGGTGCGA GCGGTGCGC GCGGTGCGG GCGGTGCGT GCGGTGAGA GCGGTGAGG GCGGTTCGA GCGGTTCGC GCGGTTCGG GCGGTTCGT GCGGTTAGA GCGGTTAGG GCTGTACGA GCTGTACGC GCTGTACGG GCTGTACGT GCTGTAAGA GCTGTAAGG GCTGTCCGA GCTGTCCGC GCTGTCCGG GCTGTCCGT GCTGTCAGA GCTGTCAGG GCTGTGCGA GCTGTGCGC GCTGTGCGG GCTGTGCGT GCTGTGAGA GCTGTGAGG GCTGTTCGA GCTGTTCGC GCTGTTCGG GCTGTTCGT GCTGTTAGA GCTGTTAGG 4 * 4 * 6 = 96 Three AAs specified by 96 synonymous words

3 ATGTAAACGTATATCGTGACAGTGGTCTGTTAGTATTCCTTTAGTCATGGTTT ATGTAAACTGGTCTGTTATCATGGTTT Genomic DNA mRNA

4 attggaaaccgaaacccgttggtcacctctgcaatagccctccctccctcacttctacaattttgtgacagtggtctt gttttctgcattctctgcttcacgtgcttgttttgttggagcgcgtttgcatgctgctttaaattctgaaatattaaa aaaatttcgaagtttttcagcacatgggatgggagttttgaatttcaattttttaaaaacatttttctgtgattagtg ccgtcgtggcacggctgttagccgcctatccggtttattcgatactttGTGAGTTTTTTGTAACTTTATGGTCGTCGA AATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAACAATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAAT AAAAAAATCGATCAGATATTCTGGAAAAAAAATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAG AAAAATAGAAAAATGAATGTTTTTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAG CAATGTTTTTCATTTTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAA TTTTTTGGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAACG CGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAATTGTTATTGTA TGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTTTTTTTGGCATTTTCTGCT ATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGTTGGACAATTTTCAGtgagcatcttat ccatcctagttctcagttcaggacttgtgcacattcgtttagagccagatattcgcaaagccttttcaccggatgatt cagatgctggataGTAAGTGACTACTGACCTTGAAGCCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAA TGTTTTTCTTTTTCTAATTCGATTTCCCTTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGA AAATTGAATTTTTTTGGAATTCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAA AAGAAAACTTTAAAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATAT GCTTTTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGtgaaacccgtgtctggctggaatactacggactcga catctatccggaacgagcattctgtatttttaccgccaagcgcgaaaattccagtattctccaggaaggcgcactggc agacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCAGatttatactgtggacaatc gactatcggcggcagttggctaccaagatggggatggacgaaaaaattgcgatccactctgcgacttgaacagcccct ttcacttgttagcgGTAGGTGGTGGTCTAGGGTGTCATTTTTCGATTTTTTCAATTATTCGATGTTTTTAGTGAAAAT CGAAAAATCTAAAAATTGAAAATCGAAAAATGAAAGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAAC AACAGGGAAAACTGAACAGAAACCTGGACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAA GTTAAAATAAAAACATTATCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGA AAAACCGAAACCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgac gcggagaaacaatggtaccacaagtgtattcacctatccggatatgccatatagcggactggatattttcctgggact tcacttgagtaatgcggattttggtaagattttttttgaaatgttaaatgaaaagttgaaaaatagtttttatgattt agccactttccagttaaaatttcatttttttaactataaaaagttctggaaaaatg

5 Struttura tipica dei geni umani esoniintroni

6 esone1introne1esone2introne2esone3 esone1 introne1 esone2 introne2 esone3 SPLICINGSPLICING eliminazione introni unione esoni GT AG

7 Lo splicing avviene in tutto il trascritto, anche nelle zone non codificanti

8 R = G, A Y = T, C

9 RC ORIORI O HO R II + = RC OR II O HO RIRI + Meccanismo di splicing estere alcool due legami fosfoesterici

10 U2AF arly U2AF si lega al tratto pirimidinico a valle del sito di ramificazione snRNP U2 si lega al sito di ramificazione (richiesta idrolisi ATP) Arg-Ser le prot SR connettono U2Af con snRNP U1 si legano insieme snRNP U5 si lega al 5ss, snRNP U6 si lega a snRNP U2 snRNP U1 è rilasciato, snRNP U5 si sposta dallesone allintrone, snRNP U6 si lega al 5ss snRNP U4 è rilasciato (richiesta idrolisi ATP), snRNP U6 e U2 catalizzano la transesterificazione, snRNP U5 si lega al 3ss, il 5 ss è tagliato e si forma il cappio il 3ss è tagliato e gli esoni vengono saldati insieme, il cappio verrà deramificato

11 introne (5ss)

12 Sm protein snRNP U1

13 C5 G16 RBD: RNA binding domain

14

15 si appaia al sito di ramificazione Sm protein snRNP U2 si appaiano con snRNA U6

16 U5 U17

17 Muscolo cardiaco 1435 Muscolo uterino Lo splicing è tessuto specifico

18 Esempio di alternative splicing di un gene umano

19 Alternative splicing tessuto specifico

20 Tutti i modi di fare splicing alternativo

21 Alcuni genomi virali subiscono splicing allinterno della cellula ospite

22 equine infectious anemia virus (EIAV)

23 AIM: SPLICING PREDICTION TOOL pre mRNA sequence mRNA structure

24

25

26 Segnali per il riconoscimento degli introni Motivi conservati

27 I segnali dei siti di splicing sono ben conservati tra le specie probabilmente la comparsa del meccanismo di splicing è molto antica

28 5splice sites

29

30

31 Binding of DAZAP1 and hnRNPA1/A2 to an Exonic Splicing Silencer in a Natural BRCA1 Exon 18 Mutant Goina E, Skoko N, Pagani F. Mol Cell Biol 2008; 28: 3850–3860 One point mutation at a time BRCA1 exon % 80% %

32 Two point mutations at a time BRCA1 exon 18 Binding of DAZAP1 and hnRNPA1/A2 to an Exonic Splicing Silencer in a Natural BRCA1 Exon 18 Mutant Goina E, Skoko N, Pagani F. Mol Cell Biol 2008; 28: 3850–3860 Complete exon 18 skipping Decreased efficiency

33 WT 5 -ACAGTTGTTGGCGGTTG-3 TACCACCC TTATT GGTTC AA CCGC G G T GTGAGTCTCGCACACACCTTCAGTTCT WT 144A 145C146A147G148T149T150G151T153G154G155C156G157G ex9 + ex9 - % exon 9 inclusion Effect of variations in CFTR exon 9 Pagani, F., Buratti, E., Stuani, C., and Baralle, F. E. (2003) J Biol Chem Pagani, F., Stuani, C., Zuccato, E., Kornblihtt, A. R., and Baralle, F. E. (2003) J Biol Chem A pathological

34 An additional exonic constraints: the splicing code

35 The genetic code is degenerate, but it is not all rodustness... Ala Val Arg... GCA C G T GTA C G T CGA C G T AGA G GCAGTACGA GCAGTACGC GCAGTACGG GCAGTACGT GCAGTAAGA GCAGTAAGG GCAGTCCGA GCAGTCCGC GCAGTCCGG GCAGTCCGT GCAGTCAGA GCAGTCAGG GCAGTGCGA GCAGTGCGC GCAGTGCGG GCAGTGCGT GCAGTGAGA GCAGTGAGG GCAGTTCGA GCAGTTCGC GCAGTTCGG GCAGTTCGT GCAGTTAGA GCAGTTAGG GCCGTACGA GCCGTACGC GCCGTACGG GCCGTACGT GCCGTAAGA GCCGTAAGG GCCGTCCGA GCCGTCCGC GCCGTCCGG GCCGTCCGT GCCGTCAGA GCCGTCAGG GCCGTGCGA GCCGTGCGC GCCGTGCGG GCCGTGCGT GCCGTGAGA GCCGTGAGG GCCGTTCGA GCCGTTCGC GCCGTTCGG GCCGTTCGT GCCGTTAGA GCCGTTAGG GCGGTACGA GCGGTACGC GCGGTACGG GCGGTACGT GCGGTAAGA GCGGTAAGG GCGGTCCGA GCGGTCCGC GCGGTCCGG GCGGTCCGT GCGGTCAGA GCGGTCAGG GCGGTGCGA GCGGTGCGC GCGGTGCGG GCGGTGCGT GCGGTGAGA GCGGTGAGG GCGGTTCGA GCGGTTCGC GCGGTTCGG GCGGTTCGT GCGGTTAGA GCGGTTAGG GCTGTACGA GCTGTACGC GCTGTACGG GCTGTACGT GCTGTAAGA GCTGTAAGG GCTGTCCGA GCTGTCCGC GCTGTCCGG GCTGTCCGT GCTGTCAGA GCTGTCAGG GCTGTGCGA GCTGTGCGC GCTGTGCGG GCTGTGCGT GCTGTGAGA GCTGTGAGG GCTGTTCGA GCTGTTCGC GCTGTTCGG GCTGTTCGT GCTGTTAGA GCTGTTAGG 4 * 4 * 6 = 96 Three AAs specified by 96 synonymous words

36 exon31 cryptic exon NF1 gene A>G ttttatagTGAGAATA WTMUT Raponi M, Upadhyaya M, Baralle D. Functional splicing assay shows a pathogenic intronic mutation in neurofibromatosis type 1 (NF1) due to intronic sequence exonization. Hum Mutat. 2006; 27(3): La mutazione attiva un esone criptico (in rosso)

37 TAGgtaata TAGgtggga TAGataata CAGgtattg CAAgtattg CAAgtaagc CAAgtaagg Raponi M, Upadhyaya M, Baralle D. Functional splicing assay shows a pathogenic intronic mutation in neurofibromatosis type 1 (NF1) due to intronic sequence exonization. Hum Mutat. 2006;27(3): exon31 cryptic exon NF1 gene Disruption of 5ss restores normal splicing La seq 2 ha un sito di splicing in 5 più debole della seq 1. La seq 3 non ha il sito.

38 ATM gene structure M WT del mut mutations results A new type of mutation causes a splicing defect in ATM Pagani F, Buratti E, Stuani C, Bendix R, Dörk T, Baralle FE Nature Genetics 2002, 30: WT: GGCCAGGTAAGTGATA DEL: GGCCAG____GTGATA MUT: GGCCAGGTCTGTGATA

39 exonic splicing enhancer ESE exonic splicing silencer ESS intronic splicing enhancer ISE intronic splicing silencer ISS Many elements regulate the splicing process

40 A compact formalism, but… score matrix

41 Experimental assessed binding sites A C G T G consensus sequence AGG AGT CGG CGT unzip AGG AGT CGT AGG CGT Compression and reconstruction of motifs zip

42 Intron definition / exon definition

43 Modello di exonic splicing enhancer mediato da proteine SR

44 Modello di exonic splicing silencer

45

46 elements promoting exons elements promoting introns

47

48 ESE, ISS: esone ESS, ISE: introne

49 9G8, CUG-BP1, DAZAP1, ETR-3, Fox-1, Fox-2, FMRP, hnRNP A0, hnRNP A1, hnRNP A2/B1, hnRNP C, hnRNP C1, hnRNP C2, hnRNP D, hnRNP D0, hnRNP DL, hnRNP E1, hnRNP E2, hnRNP F, hnRNP G, hnRNP H1, hnRNP H2, hnRNP I (PTB), hnRNP J, hnRNP K, hnRNP L, hnRNP LL, hnRNP M, hnRNP P (TLS), hnRNP Q, hnRNP U, HTra2alpha, HTra2beta1, HuB, HuD, HuR, KSRP, MBNL1, Nova-1, Nova-2, nPTB, PSF, RBM4, RBM25, Sam68, SAP155, SC35, SF1, SF2/ASF, SLM-1, SLM-2, SRp20, SRp30c, SRp38, SRp40, SRp54, SRp55, SRp75, TDP43, TIA-1, TIAL1, YB-1, ZRANB2 … PROTEINS REGULATING SPLICING STORED IN SPLICEAID

50 SEQUENCE SPLICEAIDCOMPETING TOOLS EXPERIMENTALLY ASSESSED BINDING ESE FinderRescue ESE Splicing Rainbow ACAACYB-1no bindingno ESESRp40 GAAGAAGA HTra2A, HTra2B1, SF2/ASF, SC35, SRp40, SRp55, SRp75 no binding3 ESETra2B CUGGCGUCGUCGCno binding SF2/ASF, SRp55 2 ESESRp40, SRp55 UGACUGhnRNP A1no bindingno ESESRp40, SRp55 UUUUAGACAA hnRNP C1, Sam68, hnRNP A1, hnRNP D, hnRNP E1, hnRNP E2, SRp38 no binding1 ESE hnRNP A2/B1, hnRNP C1/C2, hnRNP E1/E2, SRp40, SRp55, U2AF65 UGUGUGUGUGUGUGUGUG CUG-BP1, ETR-3, TDP43 SRp55no ESEhnRNP U Some comparisons among literature data (SpliceAid) and prediction tools

51 Pan troglodytes average nucleotide divergence of just 1.2%

52 Suggested papers Nature reviews. Genetics. 2002; 3(4): Listening to silence and understanding nonsense: exonic mutations that affect splicing. Cartegni L, Chew SL, Krainer AR. PMID: Nature reviews. Genetics. 2007; 8(10): Splicing in disease: disruption of the splicing code and the decoding machinery. Wang GS, Cooper TA. PMID:


Download ppt "Lo splicing dellRNA definizione importanza predizione Ing Francesco Piva Gruppo di biologia computazionale e molecolare Dipartimento di Biochimica, Biologia."

Similar presentations


Ads by Google