1. Ion PGM Platform: Technology & Sequencing Applications Mubasher “Bash” Dar, Ph.D. Sr. Applications Scientist Thermo Fisher Scientific

2. Agenda Ion Technology Applications on Ion Data Analysis
Overview of Ion Torrent™ Sequencing Technology
Applications on Ion
AmpliSeq (Multiplexing PCR and RT-PCR) Sequencing Data
Other Sequencing Applications
Data Analysis
Primary Analysis (Torrent Suite from Ion)
Secondary Analysis (Commercial Vendors)

3. Personal Genome Machine® Sequencer & Chip
Ion Torrent Systems, Inc.
Personal Genome Machine® Sequencer & Chip
Here is a great time to hand out some old, used chips to the crowd. Be sure to explain the reagents that are on the PGM (R1 – R4 are the dNTPs, W1 is the Ion Sphere Location Solution, W2 is the primary running solution from which everything is diluted and mixed, W3 is the auto-pH solution)
Low cost, convenient, single use device.
Easy, automatic fluid connections.
Match the size of the Ion chip to your application.

4. PGM™ System Orientation
Touchscreen
Wash 2 Solution
Chip Compartment (chip clamp/squid)
Waste Bottle
Nucleotide bottles
Wash 3 Solution
Wash 1 Solution

5. Ion Torrent Systems, Inc.
Ion Workflow Overview 10 10
Prepare
Library
Clonal
Amplification
Isolate Positive Ion Sphere™ Particles
DNA / RNA
Library Preparation
Template Preparation*
Load Chip and Sequence
Data Analysis
DNA Sequencing*
Data Analysis

6. Scalability
Simplicity
Speed

7. Ion Technology Core Principles
Ion Torrent Systems, Inc.
Ion Technology Core Principles
4/19/2017
Scalability
CMOS technology
40 years of Moore’s law
Simplicity
Natural nucleotides
No lasers
No optics
No camera
No fluorescence
No enzyme cascade
Speed
Rapid detection of sequence extension
The Chip is the Machine TM

8. Scalability: Semiconductor Technology
Ion Torrent Systems, Inc.
Scalability: Semiconductor Technology
Wafer
Chip
Chip Cross Section

9. Simplicity: Natural Chemistry
Ion Torrent Systems, Inc.
Simplicity: Natural Chemistry
4/19/2017
Main idea here is the chemistry is “natural” in the sense that we don’t modify the dNTPs. When we flow 1 dNTP at a time, if there is an incorporation, a hydrogen ion is released on each template on the Ion Sphere Particle (only one shown here). This release of H+ causes a change in the pH of the well that is detected by our “ion sensitive layer” at the bottom of each well. So the signal we detect is caused by an incorporation event, and we know what dNTP we were flowing at that time, so we infer what base was on the template. If no signal is detected (other than background) we assume no incorporation during that dNTP flow.

10. Speed: Fast Direct Detection
Ion Torrent Systems, Inc.
Speed: Fast Direct Detection
Rothberg J.M. et al Nature doi: /nature10242
Sensor Plate
Silicon Substrate
Drain
Source
Bulk
dNTP
To column
receiver
∆ pH
∆ Q
∆ V
Sensing Layer H+
Schematic representation of one microwell on the surface of a chip
High signal to noise
Enables high raw accuracy
One sensor per well per sequencing reaction
Orange circle is an Ion Sphere Particle onto which is clonally amplified the sequence fragment resulting from library preparation or amplicon PCR
Release of H+ ions as nucs incorporate generates a pH change inside the well which in turn causes charge accumulation in the Ion sensitive layer which then in turn causes a voltage increase mediated through the transistors directly underneath each well. Voltage signals are turned into base calls and output either as Ionograms (SFF files) or bases (FastQ) files
Sample at variable frame rate across pre-wash, nuc-flow, and post-wash
DNA  Ions  Sequence
Nucleotides flow sequentially over Ion semiconductor chip
One sensor per well per sequencing reaction
Direct detection of natural DNA extension
Millions of sequencing reactions per chip
Fast cycle time, real time detection

11. Ion Torrent™ Workflow: Sequencing
Ion Torrent Systems, Inc.
Ion Torrent™ Workflow: Sequencing

12. Ion Workflow – PGM™ System Sequencing Run
PGM™ System Setup for 2 runs (200bp or less)
Initialize PGM™ System and Prepare Solutions
Perform PGM™ System Cleaning
DNA A
Sequencing D
Template Prep C
Compatible Library Prep B
Compatible Data E
Perform Sequencing Run 4
Anneal Sequencing Primer 1
Perform Polymerase Binding 2
Load Ion Chip ™ Device 3

13. Ion Torrent Systems, Inc.
Sequencing: Flows
4/19/2017
A “flow” is the event of exposing the chip to one particular dNTP (T, A, C, or G), followed by a washing step
The flow order repeats with pattern:
‘TACGTACGTCTGAGCATCGATCGATGTACAGC’
HOW DO WE DEAL WITH SAMBA? NEED TO THINK ABOUT THIS AS WE DON’T WANT TO DRAW TONS OF ATTENTION TO FLOW ORDER BUT THIS CONCEPT IS IMPORTANT.
Focus on the following: The key flows are important for recognizing the type of ISP (library or control) and for identifying what a signal of “1” looks like. After that, the flow order really doesn’t matter – just show them we are sequencing by synthesis, in towards the ISP, sometimes incorporating 0 bases, 1 base, or several bases per flow. T A C G T A C G T C T G A G C A T C G A
Flows 1-4
Flows 5-8
…9-12
… etc. T A C
Ion Sphere -----Primer A G T C A A G C G T C C C A T G
...---Ion Sphere™ Particle G
Key Sequence
Sequence of Interest
Flows 1-4
A “cycle” is four consecutive dNTP flows: for instance, T-A-C-G = 1 cycle

14. Ion Torrent Systems, Inc.
Sequencing: Flows
4/19/2017
A “flow” is the event of exposing the chip to one particular dNTP (T, A, C, or G), followed by a washing step
The flow order repeats with pattern:
‘TACGTACGTCTGAGCATCGATCGATGTACAGC’ T A C G T A C G T C T G A G C A T C G A
Flows 1-4
Flows 5-8
…9-12
… etc. T A T C C
Ion Sphere -----Primer A G T C A A G C G T C C C A T G
...---Ion Sphere™
Particle G
Key Sequence
Sequence of Interest
Flows 5-8
A “cycle” is four consecutive dNTP flows: for instance, T-A-C-G = 1 cycle

15. Ion Torrent Systems, Inc.
Sequencing: Flows
4/19/2017
A “flow” is the event of exposing the chip to one particular dNTP (T, A, C, or G), followed by a washing step
The flow order repeats with pattern:
‘TACGTACGTCTGAGCATCGATCGATGTACAGC’ T A C G T A C G T C T G A G C A T C G A
Flows 1-4
Flows 5-8
…9-12
… etc. T T C T C A G T
Ion Sphere -----Primer A G T C A A G C G T C C C A T G
...---Ion Sphere™
Particle G
Key Sequence
Sequence of Interest
Flows 9+
A “cycle” is four consecutive dNTP flows: for instance, T-A-C-G = 1 cycle

16. Ion Torrent Systems, Inc.
Sequencing: Flows
4/19/2017
A “flow” is the event of exposing the chip to one particular dNTP (T, A, C, or G), followed by a washing step
The flow order repeats with pattern:
‘TACGTACGTCTGAGCATCGATCGATGTACAGC’ T A C G T A C G T C T G A G C A T C G A
Flows 1-4
Flows 5-8
…9-12 T T
… etc. C T C A G T T C G C A G G G T A C G
Ion Sphere -----Primer A G T C A A G C G T C C C A T G
...---Ion Sphere™
Particle A
Key Sequence
Sequence of Interest
And so on…
A “cycle” is four consecutive dNTP flows: for instance, T-A-C-G = 1 cycle

17. Throughput of PGM Sequencer -- Chip type Reads

18. Ion PGM™ Metrics Ion PGM™ Chip Ion User Q20 bases 314 cnservice.ion
Ion 314™ Chip
Ion 316™ Chip
Ion 318™ Chip
Series of chips build on 40 years of Moore’s law
More reads and longer read lengths within each chip
All chips on single platform with ~2 hour sequencing runs
1. PGM will continue to scale delivering 100X scalability in under one year with the addition of the 318 Chip, all with 2 hour run times
2. Within each chip we will continue to improve performance (arrows) by improving utilization (100K high quality reads on 314 chip is about 8% utilization (100,000 HQ reads /1,300,000 wells = ~8% utilization)…results from a combination of molecular biology and software improvements
3. Readlengths will continue to increase through 2011, with 200bp expected by end of year with 400bp next year. Internally Ion has seen reads of over 300bp already
Ion PGM™ Chip
Ion User
Q20 bases
314
cnservice.ion
167,753,95
316
Corebotz
789,113,176
318
1,355,996,615
External Performance
Well Beyond Spec
(Ion Community RecogntION Runs)

19. Ion Torrent™ Workflow: Template Prep
Ion Torrent Systems, Inc.
Ion Torrent™ Workflow: Template Prep

20. Ion Workflow – Template Prep
Ion Torrent Systems, Inc.
Ion Workflow – Template Prep
DNA A
Sequencing D
Template Prep C
Compatible Library Prep B
Compatible Data E 1
Assemble amplification reaction 2
Qubit ®
Fluorometer
Amplify, recover – Ion OneTouch™ 2 Instrument 3
Enrich – Ion OneTouch™ ES
Total Processing Time ~5-8 hours
Hands-On Time ~25 min.

21. Ideal Clonal Amplification
Ion Torrent Systems, Inc.
Ideal Clonal Amplification
4/19/2017
Amplification 10
Expanded view
Primers
dNTPs
Polymerase
MgCl2

22. Ion Sphere™ Particle Enrichment
Ion Torrent Systems, Inc.
Ion Sphere™ Particle Enrichment
4/19/2017
Post
Amplification
Add Magnetic
Streptavidin Bead
Immobilize to
Magnet and Wash
Denature ISP
with NaOH
Note that enrichment does not remove ‘mixed’ or ‘polyclonal’ ISPs. Those must be minimized via dilution in the template prep. *
*This species can be minimized through proper dilution.
Proper DNA to Ion Sphere™ Particle ratio is critical!

23. Ion Torrent™ Workflow: Library Prep & Ion PGM Publications Data
Ion Torrent Systems, Inc.
Ion Torrent™ Workflow: Library Prep & Ion PGM Publications Data

24. Ion AmpliSeq Technology – Multiplexing PCR and RT-PCR
AmpliSeq DNA
AmpliSeq RNA
Ready-to-Go Panel (e.g. Cancer)
Custom Panels (Any Genes)
150, 200 or 375bp
Ready-to-Go Panel (cancer & Lung)
Whole Exome
Whole Transcriptome
150bp panels are FFPE compatible
10ng of DNA or RNA required

25. Ion AmpliSeq™ Library Workflow
Prepare your samples using standard PCR techniques
Starting with just 10 ng of input DNA – compatible with FFPE samples
Leverage Ready-to-Use panels or build your own Custom panel
Automation options are available – see Appendix

26. Ion AmpliSeq™ Ready-To-Use Panels
Cancer Hotspot Panel v2
50 genes
>2,800 COSMIC Mutations
207 Amplicons
Custom AmpliSeq Panel of your genes
Comprehensive Cancer Panel
409 Genes
16,000 Amplicons
Inherited Disease Panel
700 Diseases
328 Genes
10,000 Amplicons

27. Ion PGM™ Sequencer leads the market in SNP accuracy (>90% of variation)
Venn Diagram is number of consensus errors across three platforms; PGM, MiSeq, and GS Junior.
Quote & table – source Nature Biotech paper.

28. PGM Sensitivity and Mutation Detection
Mutation Type
PGM Sensitivity
SNP
1-5%
INDELS
20%

29. Sequencing of circulating cell free DNA suggests non-invasive profiling could be used instead of metastatic biopsies
Circulating cell free DNA (cfDNA) profiled using the Ion AmpliSeq™ Cancer Hotspot Panel Instead of metastatic biopsies, sequencing on the Ion PGM™ System was used to screen metastatic breast cancer tumor (n=69) and serum (n=31) samples from 17 patients
Allele frequencies as low as 0.5% were detected 13 out of 17 (76%) had concordant tumor and plasma mutation findings
92% of findings validated Illumina technology was used to confirm 77 (92%) out of 84 samples tested. Two patient’s tumor mutations were detected in the plasma by Illumina sequencing that were not detected by Ion Torrent sequencing
Rapid, cost-effective and non-invasive method could improve patient screening “This represents a non‐invasive approach, at a reasonable cost, with a quick turnaround time. Consequently, it might increase patient access to molecular screening programs and lead to personalized treatment approaches.”

30. Sequencing platform comparison for solid tumor genomic biomarker discovery
Solid tumor genomic biomarker discovery Prospective phase I clinical trail patients samples were sequenced
Sequencing platform comparison 27 samples (FFPE and fresh frozen) were compared between the MiSeq (TruSeq Amplicon Cancer Panel) and the Ion PGM™ System (Ion AmpliSeq™ Cancer Hotspot Panel) as well as Sequenom MassARRAY (OncoCarta 1.0)
97% concordance between MiSeq and PGM variant calls At an allele frequency ≥13% and depth of coverage of ≥500% (found 91% concordance between MiSeq and Sequenom). 21 out of 27 samples showed a 100% concordance (78%) between MiSeq and PGM
Similar variant allele frequencies between MiSeq and PGM “Variant allele frequencies of gene mutations detected on both NGS platforms were strikingly similar.”
Actionable mutation discovery 57% patients (53 out of 93) were allocated clinical trials due to actionable mutations

31. Evaluation of a New High-Throughput Next-Generation Sequencing Method Based on a Custom AmpliSeq Library and Ion Torrent PGM Sequencing for the Rapid Detection of Genetic Variations in Long QT Syndrome
Custom AmpliSeq™ panel and the Ion PGM™ System were used for rapid variant detection in long QT syndrome
The AmpliSeq™ panel was designed to the five most prevalent cardiomyopathy-causing genes (KCNQ1, KCNH2, SCN5A, KCNE1, KCNE2)
Covering 86% of the targeted regions
Using 30 previously characterized samples, all variants (40 SNVs, 17 indels) were detected
NextGENe v (SoftGenetics) & Alamut were used for further signal processing, base calling, sequence alignment, and variant analysis
The future:
“Studies are ongoing to improve this approach by obtaining a more complete, faster, and cheaper molecular exploration of patients presenting with LQTS. First of all, use of either an Ion 318TM (PGM sequencer) or PITM (Proton sequencer) chips would allow analysis of more patients simultaneously in the same run. Secondly, as illustrated by the recent availability of the AmpliSeqTM exome, improvement of algorithms used by the AmpliSeqTM designer would allow exploration of an increasing number of LQTS-causing genes, for which all targeted sequences will be efficiently covered.”

32. Routine use of the Ion Torrent AmpliSeq™ Cancer Hotspot Panel for identification of clinically actionable somatic mutations
Evaluation of AmpliSeq™ Cancer Hotspot Panel v2 for somatic mutation detection
Samples used: cell line DNA; FFPE cell line DNA with genetically engineered mutations; FFPE samples with known mutations
“Our results suggest that >100× coverage is needed to identify somatic mutation results with confidence.”
Accuracy studies demonstrated 100% concordance
Variant concordance was >95% between runs
“The sources of disparity between variants called for the same library across the three chips were low variant frequency and homopolymeric sequences, both easily masked based on our decision tree.”
Limit of detection was found to be 5% for SNVs and 20% for indels
“Importantly, we were able to identify two additional actionable EGFR mutations (T790M) from this cohort that are not included in our single gene assay as it currently stands.”
“We also showed that input DNA concentrations well below those recommended by the manufacturer could result in adequate sequencing reactions. We have tailored the runs to produce robust analyses with available starting material of as little as 1 ng of DNA isolated from FFPE tissue.

33. Hereditary hearing loss: a 96 gene targeted sequencing protocol reveals novel alleles in a series of Italian and Qatari patients
Custom AmpliSeq™ panel targeting 96 genes implicated in hereditary hearing loss was sequenced using the Ion PGM™ System
Planned release as a Community Panel
12 families from Italy and Qatar were assessed with detection of a pathogenic mutation identified in 4 families (33%)
Five novel alleles were uncovered in LOXHD1, TMPRSS3, TECTA, and MYO15A
SNVs and indels with Q<20 were filtered
SNVs present in dbSNP, with recessive pattern of inheritance and MAF>0.03, and dominant mode of inheritance were excluded
Missense mutations were assessed using in silico tools PolyPhen-2 and MutationTaster

34. Custom AmpliSeq™ panel demonstrates efficient large gene genotyping and copy number detection
Common autosomal dominant disorder Dominant loss-of-function mutations in tumor suppressor neurofibromatosis type 1 (NF1) affects ~1/3000 individuals with ~50% sporadic de novo mutations
Challenging gene NF1 is a sequencing challenge due to its large size, multiple identical pseudo genes, and lack of mutational hotspots
Custom AmpliSeq™ panel sequenced efficiently on the Ion PGM™ System 48 barcoded samples were sequenced on an Ion 316™ Chip with 96% of targeted bases covered 100x. The custom AmpliSeq™ panel targeted 100% and 98.8% coding region of SPRED1 and NF1 genes, respectively
100% mutation detection Using a validation set of 30 samples with known mutations
Prospective testing identifies SNVs and CNVs Found NF1 alterations in 88% of samples (246/279) and SPRED1 and NF1 found in 92% (256/279).
Dilution experiments demonstrate good correspondence between theoretical and observed mutant allele frequencies

36. Ion RNA AmpliSeq™ Ready-To-Use Panels
RNA Cancer Panel
50 genes
Corresponds to genes in Ion AmpliSeq™ Cancer Hotspot v2
RNA Apoptosis Panel
267 genes
TaqMan® validated
RNA Custom Panel
Target any gene
300 genes in single tube

37. AmpliSeq RNA panel aids expression study of 917 iPSC-related genes with improved detection of low abundance transcripts
Roche team validates custom AmpliSeq RNA panel human genes targeted representing ~150 biological signaling cascades sequenced on the Ion Proton™ System
Stem cell differentiation model system Induced pleuripotent stem cells (iPSC) differentiated to cardiomyocytes used to assess custom AmpliSeq™ RNA panel
Comparison to microarray and RNA-seq ILMN Human Beadchip and Ion Proton™ System RNA- Seq data generated for comparison
AmpliSeq RNA panels fill important research gap “Adaptation of AmpliSeq-RNA technology to high- performance semiconductor technology closes an important gap in custom RNA analysis because it allows for the first time multi-parallel expression analysis of hundreds of genes in up to one hundred samples covering a dynamic range of five orders of magnitude.”
PM:
AmpliSeq RNA-only DEGs

39. Ion PGM – other library types
16S ribosomal RNA profiling (bacteria typing)
ChIP-Seq
Viral (RNA and DNA) Sequencing – HIV & Flu
Mitochondrial DNA sequencing
Microbial Sequencing
Reproductive Medicine (Targeted gene sequencing)
microRNA (50% of known miRNA in mirBASE detected)

41. Behind the Bench blog post:
16S rRNA profiling of meconium identifies bacteria correlated with premature birth
16S rRNA profiling on the Ion PGM™ System was used to characterize microbial communities present on meconium Meconium is a substance that lines the fetal intestines resulting from ingestion in utero. Meconium stool is passed by a newborn soon after birth, before an infant has started to digest breast milk
Bacteria correlated with premature birth Meconium from 52 infants was characterized and analysis identified: “Enterobacter, Enterococcus, Lactobacillus, Photorhabdus, and Tannerella, were negatively correlated with gestational age and have been reported to incite inflammatory responses, suggesting a causative role in premature birth.”
Gestational age has largest impact on the mecomium microbiome With mode of delivery (natural v. c- section) also having a large effect
Behind the Bench blog post:

42. Torrent Suite™ to Generate BAM Files for Analysis
Blue & orange are same file types.
Orange – uncorrected signal intensity values. Important for variant calling.
Blule – corrected signal intensity values in v. 3.2.
Unmapped
BAM
BAM
Instrument
WELLS
Variant Calling
FASTQ
SFF
VCF

43. Error Rates on PGM and chemistry type
Kit Type
% Q30 Reads
200bp Sequencing
64-68%
400bp Sequencing
57%

46. For Research Use Only. Not for use in diagnostic procedures.
Life Technologies is a Thermo Fisher Scientific brand. © 2014 Thermo Fisher Scientific, Inc. All rights reserved. TaqMan is a registered trademark of Roche Molecular Systems, Inc., used under permission and license. All other trademarks are the property of Thermo Fisher Scientific and its subsidiaries.