1. An elusive expansion at the FRDA locus Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital

2. Presentation Overview Introduction: Friedreich ataxia:  Clinical symptoms;  Molecular pathology Case 1: Diagnostic referral; CAG repeat expansion testing; Unusual TP-PCR result Case 2: Diagnostic referral; Premutation plus GAA repeat expansion within the disease-causing size range Case 3: Carrier testing; GAA repeat expansion undetected using standard analysis

3. Friedreich Ataxia (FRDA) Autosomal recessive neurodegenerative disorder; Affects the spinal column and cerebellum; Slowly progressive ataxia of the gait & limbs; Onset: 10 – 15 years of age Associated with:  Muscle weakness;  Spasticity in the lower limbs;  Absent lower limb reflexes;  Dysarthria;  Scoliosis;  Pes cavus;  Bladder dysfunction;  Loss of position and vibration sense

4. FRDA Additional clinical symptoms: ~ 30 %:  Hypertrophic non-obstructive cardiomyopathy ~ 10-25%:  Optic atrophy;  Deafness;  Glucose intolerance or  Diabetes mellitus ~ 25%:  Atypical presentation:  Later age of onset;  Retained tendon reflexes; or  Unusually slow disease progression

5. Genetics of FRDA Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of ~ 1:100 FRDA gene (Frataxin or X25) indentified in 1996: 1. Expansion of GAA triplet repeat within intron 1 = 98% mutations 5a1423 aaaaaaaaaaaaaaagaagaag aagaagaagaagaaaataaaga   Normal alleles: 5-33 GAA repeats;  Alleles > 27 repeats rare;  Premutation alleles: 34-65 GAA repeats;  Expanded alleles: > 66 GAA repeats  Some alleles have interrupted sequences: GAAGGA or GAGGAA

6. Genetics of FRDA Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of 1:100 FRDA gene (Frataxin or X25) indentified in 1996: 1. 98% mutations = expansion of GAA triplet repeat within intron 1 5a1423  106 2. 1-2% FRDA patients – GAA expansion plus inactivating mutation, (nonsense, splicing, frameshift or missense)  Homozygous expansion & compound heterozygous patients: clinically indistinguishable;  Patients with missense mutations near the carboxy-terminus have atypically mild FRDA;  No patients have been described with two identified point mutations  1  165  182

7. Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers Molecular Genetic Testing

8. Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers n/n (8/29 repeats) n/?

9. Molecular Genetic Testing Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers; b) Triplet-prime PCR n E

10. Case 1 Diagnostic referral; Expansion & point mutation analysis requested:  Institute of Neurology:  GAA repeat flanking PCR;  TP-PCR Clinical details:  52 year old female;  No further details avaliable

11. Case 1 F-PCR: Patient 1. 31 rpt control 2. Expansion control 3. Hom & Het normal controls 4. & 5. 8 repeats

12. Molecular Genetic Testing Triplet-prime PCR: cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa

13. Triplet-prime PCR: Molecular Genetic Testing cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa

14. Triplet-prime PCR: Molecular Genetic Testing cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa

15. cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa Molecular Genetic Testing

16. Case 1 TP-PCR:

17. Case 1 Modified TP-PCR: Primers: FATP-P3-F-FAM FATP-P1-R FATP-P4-F GAA Int + FATP-P4-F GAG Int

18. Case 1 Southern Blot: Patient Normal E/E n/E 1. 2. 3. 4. EcoRV FA3PEx1

19. Case 1 ? Clinical Significance: Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;

20. Case 1 ? Clinical Significance: Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures; Inhibit transcription = reduced Frataxin protein Interrupted alleles:  Triplexes less likely to form;  Not predicted to inhibit transcription of Frataxin to the same extent as pure GAA repeats;  Shorter in length (equivalent to alleles of 100-300 triplets);  May be associated with late on-set disease  (GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation alleles;  May prevent expansion into abnormal size range Clear guidelines regarding the implications of these interruptions and their clinical significance have not been established

21. Case 1 ? Clinical Significance: Patient:  1 normal allele;  1 interrupted allele;  No further mutations identified on sequence analysis Unlikely to be affected with FA; ? chance finding unrelated to the patient’s symptoms Further work:  Sequence interrupted allele Detection of interrupted:  May be difficult using standard TP-PCR;  Requires contiguous run of GAA repeats

22. Diagnostic referral:  53 year old female:  Progressive cerebellar degeneration F-PCR analysis identified an allele within the premutation range (~38 rpts); TP-PCR analysis detected the presence of an expansion Case 2

23. Southern blot analysis: Confirmed presence of an allele in the premutation size range & an expanded allele in the affected size range Case 2 Patient Normal E/E n/E 1. 2. 3. 4. EcoRV FA3PEx1

24. Case 2 ? Clinical Significance: Patient:  1 allele within premutation size range;  1 allele within affected size range;  Identified in peripheral lymphocytes Premutation alleles:  Not thought to affect transcription of the Frataxin gene;  Not thought to be pathogenic;  May show somatic instability ? if a significant proportion of such alleles expand into the affected size range in appropriate tissues, this may lead to atypical disease; Increases the likelihood of a diagnosis of FA Further work:  Testing of other tissue types;  Family studies

25. Diagnostic referral:  10 year old child:  Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction;  Two GAA repeat expansions  Mother identified as a carrier using standard testing strategy; Southern blot analysis: EcoRV FA3PEx1 Case 3 9.4 Kb - 6.5 Kb - 4.3 Kb - 23 Kb - 1 7 8

26. Diagnostic referral:  10 year old child:  Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction;  Mother identified as a carrier using standard testing strategy; Modified TP-PCR Assay:  Different locus specific P1-primer; Case 3 Standard TP-PCR Modified TP-PCR Mother Father No expansion detected

27. DNA sequencing:  Primers flanking the standard P1 priming site  30bp deletion:  Covering the whole of the standard TP-PCR P1 priming site in the patient’s father and the affected child;  Deletion present on the same allele as the expansion;  Explains why the expansion in the patient’s father could not be detected using standard TP-PCR Summary:  Samples harbouring such a deletion would give results consistent with homozygosity for the same size normal allele using these assays;  Deletion would not be detected - potentially an expansion could be missed  115 FA referrals with 1 allele in the normal range and no TP-PCR expansion were tested for the presence of this deletion  No further deletions were identified in this cohort  Likely that such a deletion is either very uncommon or private to this family Case 3 Break point Mother Father Affected child

28. Acknowledgements All within the molecular genetics laboratory Andrew Purvis Mohammed Kiron Kibria Kara Gaffing Fiona Coyne Roger Mountford

29. Thank-you for listening