1. DNA replication  DNA replication is semi-conservative  DNA polymerases  Replication origins  Assembly of the replication fork Further readings : http://www.dnaftb.org/dnaftb/ http://www.dnareplication.net/ 1 ADN  2 ADN 1

2. DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958 2

3. 3 The cell cycle Gap 1 DNA Synthesis Mitosis Gap 2 In the resting state (G 0 ), cells do not divide G0G0 3

4. 4 DNA synthesis is catalyzed by DNA-dependent DNA polymerases dNTP template strand strand to be synthesized  DNA polymerization takes place in the 5’ to 3’ direction  DNA polymerase requires a template and a primer dATP dTTP dCTP dGTP GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC DNA polymerase nucleotides GGATC CCTAGGAATCTTGGAACCGGGCCC template primer 5’ PP i Stryer et al. Biochemistry, Freeman Edt 4

5.  DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 ’ to 3 ’ direction starting at double strand DNA or at a DNA-RNA hybrid  A primase synthesize a RNA primer to initiate replication  DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation DNA replication requires a primase to start dNTP template strand strand to be synthesized 5

6. 6 Okazaki fragments RNA primase Leading and lagging strands Size of Okasaki fragments : eukaryotes 200 bp Alberts et al. MBOC, Garland Edt 6

7. 7 5’ 3’ dNTP RNA primer 5’ 3’ NTP primase Replication fork DNAPol  DNA helicase On the « leading strand », DNA is continuously synthesized 7

8. 8 5’ 3’ RNA primer dNTP RNA primer 5’ 3’ NTP DNAPol  primase 5’ 3’ dNTP RNA primer ligase 5’ 3’ RNA primer RNAse and DNAPol  Replication fork DNAPol  DNA helicase On the « lagging strand », DNA is synthesized discontinuously 8

9. 9 The core of the eukaryote replication complex Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida http://www.med.ufl.edu/IDP/BMB/bmbfacultypages/lindabloom.html  Eukaryote cells possesses several DNA polymerases (> 15)  nucleus250 kDa DNA primase, lagging strand  nucleus170 kDa leading strand  nucleus260 kDa lagging strand, DNA repair DNAPol  DNAPol  DNAPol  primase 9

10. 10 Main components of the DNA replication complex DNA polymerase  – primaseprimer RNA synthesis DNA polymerase  DNA synthesis, leading+lagging strands Replication protein C*load PCNA on DNA Proliferating cell nuclear antigen (PCNA)sliding clamp ensuring processivity TopoisomeraseAdjusts DNA supercoiling Helicase*Unwinds DNA into strands Replication protein Asingle strand DNA binding protein Flap endonuclease 1removes RNA 5’-flap Dna2 RNase H1removes RNA DNA ligase 1joins Okasaki fragments * uses ATP The replisome The catalytic core Maga and Hübscher 1996 Biochemistry 35: 5764-5777 Waga and Stillman 1994 Nature 269: 207-212 Frouin et al. 2003 EMBO reports 4: 666-670 Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: 149-157 Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins… Temporal regulation 10

11. 11 The central role of PCNA  PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp.  PCNA associates with RFC, DNA polymerases  and , Fen1/Dna2, Lig1 (+ 15 other proteins !)  PCNA is also involved in DNA repair mechanisms At 3’ OH end : RFC displaces Pol-  and loads PCNA + Pol  /  At the flap structure : RFA dissociates Pol  from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hübscher 2003 Journal of Cell Science 116: 3051-3060 11

12. 12 Replication is coordinated at replication factories  Visualization of DNA replication in living cells using GFP-PCNA  FRAP experiments shows that PCNA is stably associated to replication factories Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59 PCNA GFP 12

13. 13 Replication is coordinated at replication factories  Visualization of DNA replication in living cells using GFP-PCNA  FRAP experiments shows that PCNA is stably associated to replication factories Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59 13

14. 14  There are about 100-1000 replication origins per chromosome Replication origins are recognized by specific protein complexes : ORC ‘origin recognition complex) and MCM (minichromosome maintenance complex)  Replication speed : 10-50 bp/s  The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK) Replication starts at replication origins ORC : origin replication complex MCM : minichromosome maintenance complex Replisome 1. Activation 2. Extension 3. Termination 14

15. DNA repair  Molecular origin of DNA mutations  General repair mechanisms  The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle 15

16. Sources of DNA damage Replication errors: DNA polymerasefrequency 1/10 7 Molecular damages to DNA: OriginDNA damage number/cell.dayPossible repair Exogenoussun (1h/day)T-T dimers6-8.10 4 Y chemicaladducts 10 2 -10 5 N (base modification) radioactivitysingle strand breaks 2-4.10 4 Y (natural double strand breaks ?± background) Endogenoustemperature single strand breaks 2-4.10 4 Y free radicalsadducts/breaks 10 4 Y metabolitesadducts 10 2 Y virusesgenome integration ?N transposons ?? 16

17. DNA repair mechanisms Damage typeRepair T-T dimers Adducts Single strand breaks Double strand breaks  Restriction  Excision  Synthesis  Ligation  Excision  Recombination  Ligation  or direct ligation  Recognition 17

18. The COMET assay to measure DNA damages also called single cell gel electrophoresis (SCGE) 18

19. Ames test (Salmonella-his reversion-test ) for mutagenicity This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions Inhibition zone growth ring chemical to be tested 19

20. Exemple of repair : thymine dimers Tymine dimer repair enzyme : specific DNA endonuclease (induced by UV light) 20

21. benzo[a]pyrene (BP) Metabolism et carcinogenicity of Benzo[a]Pyrene benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L induction of specific mRNA (AhRE) AhR-L Growth Differentiation Metabolism (toxicity) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) translocation to the nucleus AhRE 21

22. Shimizu et al. (2000) PNAS 97 : 779-782 Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Dossier INSERM Dioxines dans l’environnement. Quels risques pour la santé ? http://ist.inserm.fr/basisrapports/rapport.html Individual susceptibility to xenobiotics. Exemple of CYP genes 22

23. DNA recombination : programmed random modifications of the genome ADN1 + ADN2  ADN3 + ADN4  Molecular mechanisms of homologous recombination  Site specific recombination  Conjugation, mechanism of bacterial parasexuality  The VDJ recombination, one of the mechanisms that generate antibody and TCR diversity  The crossing-over at meiosis increases genomic diversity in the population  Transposons and viruses are mobile DNA/RNA sequences 23

24. 1. Homologous recombination Condition : presence of two homologous sequences in adjacent chromosomes or DNA molecules

25. homology cleavage 1 ligation exchange displacement (branch migration) Holliday junction cleavage 2 ligation The mechanism of homologous recombination 25

26. ATP binding site ATP hydrolysis RecA proteins catalyze the exchange of DNA strands... Structure of a RecA polymer 26

27. … dans un seul sens without RecAwith RecA Driving force : ATP hydrolysis … in the 5’ to 3’ direction 27

28. Recombination events in cells Example CellsEffect Effector proteins Crossing-over Meiotic cells genomeRecA-D like (  germinal cells)rearrangementsproteins Virus integrationHost cell genomedormancyIntegrase lytic/lysogenicIntegration Host phasesFactor ConjugationBacteriagene exchangeIntegrase VDJ recombinationlymphocytesantibody and Rag1-2 TCR diversity Transposonsall cellsgenomeTransposases rearrangements 28

29. example of a diploid organism with 2 pairs of homologous chromosomes MITOSIS MEIOSIS FECUNDATION diploid 4 haploids gametes 2 diploids diploid 2 haploids Mitosis, meiosis and fecundation 29

30. DNA replication decondensation of chromosomes separation of daughter cells (cytokinesis) Chromosome condensation centromere s Sister chromatides separation of sister chromatides Mitotic spindle Mitosis : 1 diploid -> 2 diploids 30

31. DNA replication separation of homologous chromosomes gametes Chromosome condensation centromere Sister chromatids Pairing of homologous chromosomes synaptolemal complex 1 st mitosis 2 nd mitosis Meiosis : 1 diploid -> 4 haploids 31

32. DNA replication segregation of homologous chromosomes gametes Chromosome condensation centromer sister chromatids Pairing of homologous chromatids and crossing-over synaptolemal complex 1 st mitosis 2 nd mitosis Recombination during meiosis 32

33. « Crossing over » Mitochondrial DNA transmission  Exclusive transmission of mother mitochondria simple double  homologous sequence  frequency : 1/10 7 base pairs, at least one per chromosome paternal chromosome maternal chromosome Epigenetics  Some genes are inactivated by methylation, the methylation state can be transmitted to daughter cells.  Example : inactivation of one chromosome X in women Non-Mendelian transmission 33

34. ampicilline R blasticidine R target gene blasticidine R Recombination (double crossing-over) WT PHG1A  phg1a  phg1b  phg1a/b PHG1B Anti-PHG1B Anti-PHG1A Benzhegal et al. 2002 Application of recombination : gene knock-out by insertion 34

35. 2. Site-specific recombination Condition : presence of a specific sequence repeated twice Mechanism : specialized protein complex, no branch migration

36. Specific case : recombination with a circular DNA molecule Simple recombination Double recombination Recombination with circular DNA : local double recombination (no branch migration)

37. The two states of the bacteriophage Reversible recombination DNA of the bacterio phage DNA of E. coli attP attB Recombinant DNA Integrase Integration Host Factor Excisionase Integrase Integration Host Factor Example 1 : site-specific recombination of a virus 37

38. Integrase mechanism phage DNA E. Coli DNA attP attB recombinant DNA pairing, double cleavage, double exchange, ligation 38

39. Conformation 1 : phage and bacterial DNA separated Conformation 2 : phage and bacterial DNA fused attBattP bacterial DNA phage DNA 39

40. Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 : 1059-1066 integration excision Phage integration in bacterial genome 40

41. Conjugation Reversible recombination « female » « male » DNA episome F factor F bacterial chromosome Hfr chromosome plasmide F ’ integration excision  F’ plasmids often carry virulence factors Example 2. The F-factor allows gene exchange between bacteria 41

42. Example : light chain  of antibodies Example 3 : genetic rearrangements in B lymphocytes recombination RAG : recombination activating genes RSS : recombination signal sequences splicing 42

43. 43 In every V-region recombination event, the signals flanking the gene segments are brought together to allow recombination to take place. Immunobiology: The Immune System in Health and Disease. 5th Ed.Janeway CA et al. New York: Garland Science; 2001. In some cases, as shown in the left panels, the V and J gene segments have the same transcriptional orientation. Juxtaposition of the recombination signal sequences results in the looping out of the intervening DNA. Heptamers are shown in orange, nonamers in purple, and the arrows represent the directions of the heptamer and nonamer recombination signals. Recombination occurs at the ends of the heptamer sequences, creating a signal joint and releasing the intervening DNA in the form of a closed circle. Subsequently, the joining of the V and J gene segments creates the coding joint. In other cases, illustrated in the right panels, the V and J gene segments are initially oriented in opposite transcriptional directions. Bringing together the signal sequences in this case requires a more complex looping of the DNA. Joining the ends of the two heptamer sequences now results in the inversion and integration of the intervening DNA. Again, the joining of the V and J segments creates a functional V- region exon.

44. Applications of recombination : the Cre-Lox system Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences : LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson 44

45. Inducible tissue specific promoter Mating

46. 3. Transposon and viruse integration in the genome Condition : random (?) integration in the genome Mechanism : specialized protein complex, no branch migration, duplication of ends

47. Transposons are mobile DNA sequences in genomes excisioninsertiontranscription traduction transposase example : Tn5 transposon and transposase 47

48. The presence of transposons allows gene duplication, inversion or excision by homologous recombination DELETION INVERSION DUPLICATION 48

49.  no specific insertion sites  frequency of mobility: 10 -6 per generation  Abundance variable in genomes (10% in drosophila, 40% in men)  coat proteins  use receptors to enter the cells type I transposons (retrotransposons) type II transposonsDNA viruses RNA viruses Viruses and transposons TransposonsViruses 49

50.  Fast viruses  Slow viruses Fast and slow viruses 50 Virus entry by fusion of the virus envelope with the plasma membrane thanks to cell receptors For RNA viruses, a reverse transcriptase copy their RNA into DNA The virus takes control of the cell Production of viral proteins and nucleic acids, formation of new virus particle Cell death Genome integration Silent expression Dormancy

52.  22 paires de chromosomes autosomaux homologues C i p /C i m  2 chromosomes sexuels X m /Y p Père  22 paires de chromosomes autosomaux homologues C i p /C i m  2 chromosomes sexuels X m /X p Mère  22 chromosomes autosomaux C i p ou C i m  1 chromosome sexuel X m ou Y p spermatozoïdes  22 chromosomes autosomaux C i p ou C i m :  1 chromosome sexuel X m ou X p ovules  22 paires de chromosomes autosomaux homologues C i p ou C i m / C i p ou C i m  2 chromosomes sexuels X m ou Y p / X m ou X p Enfant 2 46 = 10 13 possibilités Transmission des caractères parentaux chez l ’homme 52

53. Un gène génotype phenotype allèles lignées puresA/Aa/a F f A/a F A/Aa/aA/a F fF 0.250.250.5 hybride de 1 ière génération hybrides de 2 de génération Deux gènes A/a B/bA/a B/b F G F G hybride de 1 ière génération B/BB/bb/b A/A FGFGFg A/a FGFGFg a/a fGfGfg B/BB/bb/b A/A 1/161/81/16 A/a 1/81/41/8 a/a 1/161/81/16 indépendants gènes portés par deux chromosomes différents (ou éloignés cf crossing-over) B/BB/bb/b A/A 1/400 A/a 01/20 a/a 001/4 liés gènes portés par le même chromosome AB/ab B/BB/bb/b A/A 1/4-2eee 2 A/a e1/2-2e 2 e a/a e 2 e 1/4-2e crossing-over e : fréquence de crossing-over, dépend de la distance entre les gènes (cMg :: e = 0.01) Génétique mathématique 53

54.  Chez E. coli, la recombinaison homologue a lieu à des sites spécifiques appelés « chi site » dont la séquence est GCTGGTGG, situés environ toutes les 4000 paires de base  Chez E. coli, la recombinaison est catalysée par l ’action de quatres protéines RecA, RecB, RecC et RecD L’ADN simple brin est généré par l ’action d ’une hélicase et d’une endonuclease du complexe RecBCD 54