Presentation is loading. Please wait.

Presentation is loading. Please wait.

LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE.

Similar presentations


Presentation on theme: "LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE."— Presentation transcript:

1 LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE

2 Uno sguardo alla nuova biologia Alessandro Quattrone

3 Colture cellulari

4 Affollamento macromolecolare Linterno delle cellule è un ambiente molto denso ed affollato

5 Livelli di osservazione nelle cellule

6 Una visione semplice della cellula

7 I cromosomi umani

8 Dai cromosomi al DNA

9 Il DNA ( D eoxyribo N ucleic A cid)

10 A-type B-type Z-type Il DNA ( D eoxyribo N ucleic A cid)

11 Le quattro basi del DNA A G C T PYRIMIDINES PURINES

12 Appaiamento obbligato delle basi

13 Duplicazione del DNA

14 Le sequenze di DNA CAACCTTTGGGATGTGTGCATGGTGGCAAGGGGCTGACTGATATGAGATTACTTCTTTTA AGGGAAATTGTCATTAATGAGTCAAGAAACTGCTCATTTATGATAATTAGCACCATGGAG CCTCAGGTGTCAAATGGTCCGACATCCAATACAAGCAATGGACCCTCCAGCAACAACAGA AACTGTCCTTCTCCCATGCAAACAGGGGCAACCACAGATGACAGCAAAACCAACCTCATC GTCAACTATTTACCCCAGAATATGACCCAAGAAGAATTCAGGAGTCTCTTCGGGAGCATT GGTGAAATAGAATCCTGCAAACTTGTGAGAGACAAAATTACAGGACAGAGTTTAGGGTAT GGATTTGTTAACTATATTGATCCAAAGGATGCAGAGAAAGCCATCAACACTTTAAATGGA CTCAGACTCCAGACCAAAACCATAAAGGTCTCATATGCCCGTCCGAGCTCTGCCTCAATC AGGGATGCTAACCTCTATGTTAGCGGCCTTCCCAAAACCATGACCCAGAAGGAACTGGAG CAACTTTTCTCGCAATACGGCCGTATCATCACCTCACGAATCCTGGTTGATCAAGTCACA GGAGTGTCCAGAGGGGTGGGATTCATCCGCTTTGATAAGAGGATTGAGGCAGAAGAAGCC ATCAAAGGGCTGAATGGCCAGAAGCCCAGCGGTGCTACGGAACCGATTACTGTGAAGTTT GCCAACAACCCCAGCCAGAAGTCCAGCCAGGCCCTGCTCTCCCAGCTCTACCAGTCCCCC AACCGGCGCTACCCAGGTCCACTTCACCACCAGGCTCAGAGGTTCAGGCTGGACAATTTG CTTAATATGGCCTATGGCGTAAAGAGGTTCTCCCCAATTACCATTGATGGAATGACAAGC CTTGTGGGAATGAACATCCCTGGTCACACAGGAACTGGGTGGTGCATCTTTGTCTACAAC CTGTCCCCCGATTCCGATGAGAGTGTCCTCTGGCAGCTCTTTGGCCCCTTTGGAGCAGTG AACAACGTAAAGGTGATTCGTGACTTCAACACCAACAAGTGCAAGGGATTCGGCTTTGTC ACCATGACCAACTATGATGAGGCGGCCATGGCCATCGCCAGCCTCAACGGGTACCGCCTG GGAGACAGAGTGTTGCAAGTTTCCTTTAAAACCAACAAAGCCCACAAGTCCTGAATTTCC CATTCTTACTTACTAAAATATATATAGAAATATATACGAACAAAACACACGCGCGCACAC ACACACATACACGAAAGAGAGAGAAACAAACTTTTCAAGGCTTATATTCAACCATGGACT TTATAAGCCAGTGTTGCCTAAGTATTAAAACATTGGATTATCCTGAGGTGTACCAGGAAA GGATTTTATAATGCTTAGAAAAAAAGAAAAAAAAA

15 Flusso dellinformazione: il Dogma Centrale need a code

16 Il codice genetico

17 Una visione moderna del Dogma Centrale

18 July 25, 2005 Issue of Science The great, hard questions that point to critical gaps in our scientific knowledge What Is the Universe Made Of? Can the Laws of Physics be United? What Is the Biological Basis of Consciousness? Why Do Humans Have So Few Genes? What Controls Organ Regeneration? How Can a Skin Cell Become a Nerve Cell? How Does a Single Somatic Cell Become a Whole Plant? What Genetic Changes Made Us Uniquely Human?

19 Il flusso duale dellinformazione nella vita development organism (mortal) germinal cell line (immortal)

20 Una curiosa conseguenza: il clonaggio di individui

21 Il flusso difettivo: malattie multigenic and multifactorial diseases(complex) single gene diseases (genetic)

22 Geni e malattie malattie a gene singolo malattie a gene singolo una sola lesione molecolare una sola lesione molecolare stessa mutazione stesso gene ma mutazioni diverse malattie complesse malattie complesse più lesioni molecolari copresenti: più lesioni molecolari copresenti: in geni differenti di peso differente in combinationi differenti

23 La visione dallalto con dettaglio 21 novembre 1783, Pilâtre de Rozier e marchese d'Arlandes

24 Diversità biomolecolare

25 La visione dallalto con dettaglio

26 Gli spazi omici genoma (DNA) trascrittoma (mRNA) proteoma (proteine) metaboloma (piccole molecole)

27 Il genoma umano, alla fine Nature 431, 931 - 945 (21 October 2004) Finishing the euchromatic sequence of the human genome International Human Genome Sequencing Consortium The sequence of the human genome encodes the genetic instructions for human physiology, as well as rich information about human evolution. In 2001, the International Human Genome Sequencing Consortium reported a draft sequence of the euchromatic portion of the human genome. Since then, the international collaboration has worked to convert this draft into a genome sequence with high accuracy and nearly complete coverage. Here, we report the result of this finishing process. The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers 99% of the euchromatic genome and is accurate to an error rate of 1 event per 100,000 bases. Many of the remaining euchromatic gaps are associated with segmental duplications and will require focused work with new methods. The near- complete sequence, the first for a vertebrate, greatly improves the precision of biological analyses of the human genome including studies of gene number, birth and death. Notably, the human genome seems to encode only 20,00025,000 protein-coding genes. The genome sequence reported here should serve as a firm foundation for biomedical research in the decades ahead. The sequence of the human genome encodes the genetic instructions for human physiology, as well as rich information about human evolution. In 2001, the International Human Genome Sequencing Consortium reported a draft sequence of the euchromatic portion of the human genome. Since then, the international collaboration has worked to convert this draft into a genome sequence with high accuracy and nearly complete coverage. Here, we report the result of this finishing process. The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers 99% of the euchromatic genome and is accurate to an error rate of 1 event per 100,000 bases. Many of the remaining euchromatic gaps are associated with segmental duplications and will require focused work with new methods. The near- complete sequence, the first for a vertebrate, greatly improves the precision of biological analyses of the human genome including studies of gene number, birth and death. Notably, the human genome seems to encode only 20,00025,000 protein-coding genes. The genome sequence reported here should serve as a firm foundation for biomedical research in the decades ahead.

28 Convergence Genome Sequencing: read Nanobiotecnology: measure DNA manipulation and synthesis: perturb & reproduce Mining and Modelling Algorithms: interpret & predict 1979 Recombinant DNA In bacteria 2008 Synthetic DNA breakthrough 1995 First bacterial genome 2001 First metazoan genome 2003 Human genome 1989 Recombinant DNA In mice 2005 Synthetic Biology methods 2006 30 vertebrate genomes 2008 Individual human genomes 1992 Photolitography for microarrays 2005 Microfluidics and nanobiosensors 1998 Spotting for microarrays 2000 Mass Spectrometry for proteins 1940 Models of excitable cell behaviour 2002 Prediction phenotype models 1995 Sequence annotation algorithms 1998 Ontologies in Biology new biology

29 Convergence Genome Sequencing: Systems Nanobiotecnology: Systems/Synthetic DNA manipulation and synthesis: Synthetic Mining and Modelling Algorithms: Semantic new biology

30 Convergence Genome Sequencing sequence/disease association Clinical Data Recording

31 Convergence Nanobiotecnology predictive medicine Clinical Data Recording Mining and Modelling Algorithms

32 Convergence DNA manipulation and synthesis Mining and Modelling Algorithms synthetic biology

33 Sequenziatori

34 Sequenziatore di nuova generazione

35 Sequenziamento individuale 2003: TDG 2003: TDG the thousand dollar genome 2007: Solexa 2007: Solexa sequenziamento massivo all1% del costo attuale

36 Linterattoma umano

37 I genomi individuali

38 La visione dallalto con dettaglio

39 Un grafico importante

40 Limmagine dinsieme?

41 Data Integration

42 Personal Genetics

43

44 I business della genomica nutrigenomicafarmacogenomicatossicogenomica Prescrizioni di farmaci su base individuale, farmaci meno tossici e più efficaci Farmaci più selettivi Industria farmaceutica Industria biotecnologica Diete e supplementi su base individuale Industria alimentare Industria dei diagnostici Identificazione su base individuale dei composti pericolosi Misure atte ad evitare sostanze tossiche nellambiente domestico e di lavoro Industria dei diagnostici Industria chimica una vita più lunga e più in salute, invecchiamento rallentato, decremento del tasso di incidenza di malattie e cure più efficaci

45 3 A synthetic world Thomas Knight, Jr: from ARPANET to the new biology through artificial intelligence

46 Composable set of genetic building blocks (genes, short pieces of DNA). – More than 2,000 today Consist of sensors, actuators, input and output devices, and regulatory elements. Each BioBrick can send and receive standard biochemical signals and be cut and pasted into a linear sequence of other BioBricks Biobricks

47 PS PS PS +

48

49 3 Biobrick Assembly Tre mCMV UAS mCMV CMV... FLAG cMyc HA GST... Protein Targeting NLS Myri GFP RFP RLuc... Your Protein of Interest... RNA-Related IRES2 Kozak Long ½ life Stops Kozak Short ½ life SV40 pA Done in 5 assemblies!

50 3 Biobrick Assembly

51 iGEM 2007: more than 600 students at 60+ universities competed using and creating BioBricks: -Biosensors for the detection of arsenic or lead in drinking water. - E. coli robots that freeze, smell, swell and time-keep. -Stem cells to repair infarcted hearts. -Viruses which selectively kill cancer cells. -Implementing memory capabilities in bacterial colonies. Adventures in Sinthetic Biology


Download ppt "LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE."

Similar presentations


Ads by Google