1. Sources of variation

2. Mutation produces variation at multiple scales:

3. Larger mutations in alleles Microsatellites Examples: AGTCCTGAGATTGGATATATATATATGTAGTACGGTACC AGTCCTGAGATTGGATATATATATATATGTAGTACGGTACC

4. Larger mutations in alleles Transposons

5. Chromosomal mutations Large-scale chromosomal rearrangements: Inversions Transpositions/Translocations

8. Consequences of inversions Keep favorable allele combinations from recombining Could selection favor inversions? Perhaps.

9. Selection favoring inversions Figure 4.11

10. New genes: gene duplications Alu Gene1 crossover Gene2 Alu Gene1Gene2 AluGene1’ AluGene2 Duplicate Deletion

11. Fate of duplicated genes

12. Fate of gene duplicates: globins Fig 4.9

13. Fate of duplicated genes: change in expression gestation (weeks) postnatal age (weeks) percent of total globin synthesis Fig 4.8

14. Gene families FamilyNumber of duplicates actin Histones Immunoglobins

15. Approaches to studying mutation Classical: study of loss of function Comparative: sequence from two species Experimental: mutation accumulation

16. Mutation rates for single-celled, asexual organisms (estimated from loss of function) 0.0015 to 0.0030 mutations per genome per generation (2.2 to 5.4 x 10 -10 per nucleotide)

17. Multi-cellular, sexual organisms Organism Mutations per genome per generation Mutations per nucleotide per generation C. elegans (worm)0.0362.0 x 10 -9 D. melanogaster (fruit fly) 0.148.5 x 10 -9 M. musculus (mouse)0.91.1 x 10 -9 H. sapiens1.62.3 x 10 -8

18. Species comparisons GH Pan (chimps) Pongo pygmaeus (orangutan) H. sapiens Gorilla gorilla P Common ancestor

19. Species comparisons Divergence time? Which sequences? Gorilla: AGTCCTAGGTGTTACTGATGGGCAT Human: AGTGCTAGGTGTTAATGATGGCCAT Chimp: AGTCTTAGGAGTTAC–GATGGGCAT

20. Mutation accumulation Attempt to limit effects of selection Caenorhabditis elegans Hermaphrodite – can self-fertilize Nematode

21. Mutation accumulation: experimental design generation 0 reproduce generation 1 transfer one individual reproduce Repeat 500 generations; 74 replicate lines Start with single inbred strain

22. Mutation accumulation Compare DNA sequences Generation 0:AACTAGCGTACCG Generation 50: AATTAGCGTACCG Generation 100:AAT- AGCGTACCG

23. A puzzle: mutation rates Why do some mutation rates differ?

24. Effects of mutations

25. Selection – Mutation balance A new deleterious mutation is completely recessive Mutations will be removed by selection, but added each generation at rate  p. At equilibrium, mutations added will equal deleterious alleles removed. Then, p(t+1) = p(t)

26. Mutation selection balance II p(t + 1) – p(t) = -  p If we use selection coefficients, this is easier AAAaaa Fitness Solve for q: We can do the same if the deleterious allele is partially recessive (but this requires some approximations)

27. Mutation selection balance III If a new deleterious mutation is completely recessive (h = 1) then q eq = squareroot(-  /s) If a new deleterious mutation is partially recessive (1 > h > 0.5) then q eq = -  / hs

28. Example spinal muscular atrophy: lethal, autosomal recessive Frequency in human population: 0.01 Selection coefficient: -0.9 What is the mutation rate under mutation – selection balance?

29. Mutations are random!

30. Levels of variation How much variation is there? Prediction?

31. Allozymes (= alternate alleles of metabolic enzymes)

32. Quantifying variation: Polymorphism & Heterozygosity Populations with higher allele variability will be more heterozygous Heterozygosity:

33. Genetic variation is rampant but varies among groups –vertebrates: mode 3- 5% –invertebrates: mode 8- 15% –plants: varies depending on mating system

34. Larger populations have higher genetic diversity Gillespie, 1992

35. Mutations and Variation Big questions –How do genes change? –How do new genes come about? What we need to know –How much variation exists, and why? –What types of mutation are important? How often do they occur? –What are their effects?

36. Readings and questions Denver, D. et al. 2000. High direct estimate of the mutation rate of the mitochondrial genome of Caenorhabditis elegans. Science 289: 2342-2344. Denver, D. et al. 2004. High mutation rate and predominance of insertions in the Caenorhabditis elegans nuclear genome. Nature 430: 679-682. Drake, J. W. et al. 1998. Rates of spontaneous mutation. Genetics 148:1667-1686. Vassilieva, L. et al. 2000. The fitness effects of spontaneous mutations in Caenorhabditis elegans. Evolution 54: 1234-1246. Chapter 5, particularly 5.1-5.3 (chapter 4 in 3 rd edition) Questions 1, 5, 6, 1and 14, and... In mammals, sperm cells are produced by constant cell division, while egg cells are produced only during fetal development. Given this, which gametes are likely to contribute more mutations to the next generation? Which gametes are more likely to show increasing number of mutations due to increasing age?