1. 1 Speaker: Jakob Fredslund, computer scientist, post doc. at Bioinformatics Research Centre, Aarhus University.

2. 2 Talk overview 1.Overall project scenario 2.PriFi – finding primers based on a multiple alignment 3.Web version 4.PriFi demo 5.Project results 6.Project pipeline demo

3. 3 Overall project aim Development of General molecular markers for legume genetics –unique, variable, known sequence –markers may be associated with important breeding traits –many markers  greater chance of trait association –general: each marker should be shared by all legumes PCR primers for the markers –One set per marker, should work for all legumes

4. 4 CATS – comparative anchor tagged sequences Alignment of ESTs from multiple legume species Align to genomic region Intron Identification of evolutionarily conserved regions Design PCR primers in conserved regions - Hopefully primers work in related species too Amplification of intron - Weak selection pressure on introns  good chance of finding polymorphism

5. 5 Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294, Doyle & Luckow 2003 18.000 species  General legume markers would be very useful! Legume Taxonomy Genomic sequences Genomic sequences Arachis (peanut)

6. 6 Legumes We don't have a complete legume genome If incomplete genome is used: –Markers may have undiscovered paralogs in genome and hence also in other legumes –Won't know which sequence we're actually reading with PCR Use complete Arabidopsis thaliana genome instead Genomic regions that haven't been sequenced ? ACGCATCGATTCGCGAACTG

7. 7 Arabidopsis and legumes If Arabidopsis has 2 copies of some gene, its legume ortholog probably exists in only 1 copy EST has 1 or 2 hits in Arabidopsis  probably unique in legumes  useful as marker candidate Arabidopsis Legumes whole genome duplication

8. 8 Large-scale: Legume pipeline

9. 9 Primer design introns replaced by X'es to help Clustal Good marker region Usual method: Visual inspection of alignment  "manual" design of primers. Idea: automate primer design through computer program. Primer consensus sequences: Fw: TGCYTCAAAGGAGGAAATTTCAARAG Rv: CTGTCAAYACCAGTATTTGCCCKKG

10. 10 Lab practice Work method: go through numerous examples with lab people while they explain what they do and why. The "why" turned out to be difficult: Hard rules hard to formulate –"So T m must always be above 55°." –"Yes. Unless.. " Rules often contradictory –"But then the primer violates the AT content rule??" –"It does? Well then the rule should be rephrased to.." Scoring primer pairs –"Why is this primer pair better than this one?" –"It just is!"

11. 11 Primer finder program PriFi Works with alignment (or Fasta file which it aligns itself using Clustal). 1.Identifies conserved regions and locates introns 2.Identifies individual primer candidates –Checks most criteria 3.Considers pairs of primer candidates –Checks remaining criteria 4.Ranks all pairs 5.Suggests four pairs and explains their scores –Lets user make informed choice (discussions showed primer design is not exact science!).

12. 12 Report Fw 5'-ATCCGATTTCGAGAAATGCAAACCCTGGTTGATCC Rv 5'-CCCTTCACAGTGGTGATACACTTTCGCTTGTTACG Tm = 66.4 / 66.9 Primer lengths: 35 / 35 Avg. #sequences in primer alignments: 3.0 / 2.0 Estimated product length: 1785 Primer/intron distances: 36 / 88 A/T's among last 8 bp of 3'-end: 4 / 5 Ambiguities: 0 / 0 93.2: High-Tm bonus 6.0: Fw primer length 6.0: Rv primer length 24.7: bonus for #sequences in primer alignments 3.0: Fw has G/C terminal in 3'-end 3.0: Rv has G/C terminal in 3'-end 60.0: Good product length -5.0: Rv in unconserved region or based mostly on 2 seqs -11.3: Primer/intron distance(s) outside 70-150 bp -3.0: Too high AT content in 3'-ends Score: 176

13. 13 PriFi on the web Can't do batch runs, otherwise same program

14. 14

15. 15 Configuration Critical melting temperature If both primer melting temperatures are below this value, penalize the pair. Optimal PCR product length interval Penalty Ok Optimal Ok Penalty p1p1 p2p2 p3p3 p4p4 PCR prod len points Introns in sequences If set to 'no', primer pairs do not have to span an intron (and introns are not marked by X'es). Somewhat heuristic parameters and rules..

16. 16 PriFi demodemo

17. 17 PriFi user statistics 2109 true hits in total. Users from 37 countries.

18. 18 Project results in interactive web tableweb table

19. 19 Status Genomic data from Medicago and Lotus, ESTs from Medicago, Lotus, Glycine, Arachis, Phaseolus. PriFi found primer pairs for 400 alignments. 92 primer pairs tested in Phaseolus: –57 usable, correct bands, 38 markers 90 tested in Arachis –43 usable, correct bands, 34 markers

20. 20 Web-based pipelinepipeline

21. 21 Thanks for your attention. Email: jakobf@birc.au.dkjakobf@birc.au.dk http://cgi-daimi.au.dk/cgi-chili/PriFi/main http://cgi-daimi.au.dk/cgi-chili/GeneticMarkers/table http://cgi-daimi.au.dk/cgi-chili/GeMprospector/main People involved in developing PriFi: Leif Schauser (BiRC), Lene H. Madsen, Niels Sandal (Dept. of Mol. Biology). Grant holder: Jens Stougaard.