Presentation is loading. Please wait.

Presentation is loading. Please wait.

GenXPro GmbH, Frankfurt am Main Our expertise at your demand.

Similar presentations


Presentation on theme: "GenXPro GmbH, Frankfurt am Main Our expertise at your demand."— Presentation transcript:

1 GenXPro GmbH, Frankfurt am Main Our expertise at your demand

2 Our Service Portfolio - Digital Gene Expression Service: from cells/tissues to annotated/BLASTed libraries inone to three month -Normalization of cDNA, sequencing and assembly - RNA seq, microRNAs - Taq-Man assays, Real-Time PCR service - Identification of SNPs, molecular (genetic) markers - Copy number variations (CNVs) - Epigenetics

3 SuperTag Digital Gene Expression Profiling (ST-DGE) An Improved version of SuperSAGE, applying second generation sequencing and a bias free PCR technology for optimal tag-to-gene association and quantification. Transcriptome Analysis & Gene Discovery

4 5353 AAAAAAA-3 TTTTTTT-5 cDNA Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 Tagging Enzyme Anchoring Enzyme Sequencing of Millions of 26 bp SuperTags Counting, BLAST Digital Gene expression Profiling Principle What Gene is expressed and how often ?

5 5353 AAAAAAA-3 TTTTTTT-5 cDNA Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 1.Digestion with Anchoring Enzyme Digital Gene expression Profiling Principle

6 5353 AAAAAAA-3 TTTTTTT-5 cDNA Digital Gene Expression Profiling Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 Principle 1.Digestion with Anchoring Enzyme What Gene is expressed and how often ?

7 Digital Gene Expression Profiling Principle 2. First Linker Ligation Linker 1 3. Digestion with Tagging Enzyme 4. Recovery of Linker-Tags What Gene is expressed and how often ? 1.Digestion with Anchoring Enzyme AAAAAAA-3 TTTTTTT-5 cDNA Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 Highly specific 26bp SuperTags

8 Digital Gene Expression Profiling Principle 2. First Linker Ligation Linker 1 3. Digestion with Tagging Enzyme 4. Recovery of Linker-Tags What Gene is expressed and how often ? 1.Digestion with Anchoring Enzyme AAAAAAA-3 TTTTTTT-5 Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 5. Second Linker Ligation Linker 2 5. PCR

9 Digital Gene Expression Profiling Principle 2. First Linker Ligation 3. Digestion with Tagging Enzyme 4. Recovery of Linker-Tags What Gene is expressed and how often ? 1.Digestion with Anchoring Enzyme AAAAAAA-3 TTTTTTT-5 Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 6. Next-Generation Sequencing Sequencing of Millions of Tags 7. Counting of Tags, Bioinformatics Counting, BLAST 5. Second Linker Ligation 5. PCR Linker 1 Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2 Linker 1Linker 2

10 5353 AAAAAAA-3 TTTTTTT-5 cDNA Streptavidin-Beads AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 AAAAAAA-3 TTTTTTT-5 Tagging Enzyme Anchoring Enzyme Sequencing of Millions of 26 bp SuperTags Counting, BLAST Digital Gene expression Profiling Principle

11 Quality of digital gene expression data depends on: 1. Quality of the Tag (what gene is expressed?) Quality Digital Gene Expression Profiling 2. Quantity of the Tags (how often is the gene expressed?)

12 The Tagging Enzyme determines Quality of Tags: LongSAGE, other DGE platforms MmeI: 5- GGGACNNNNNNNNNNNNNNNNNNNN-3 3- CCCTGNNNNNNNNNNNNNNNNNN-5 5-CAGCAGNNNNNNNNNNNNNNNNNNNNNNNN -3 3-GTCGTCNNNNNNNNNNNNNNNNNNNNNNNNNN-5 SuperSAGE, SuperTAG-DGE EcoP15I : 26 bp (=SuperTAG) bp Tag-Quality

13 What gene? SuperTAGs allow unequivocal Identification of the corresponding Gene Tag Quality EnzymePlatformTag-Sizee-value BsmFI-TagSAGE14 bp105 MmeI-TagLongSAGE, Other platforms18-20 bp0,34 EcoP15I-TagSuperSAGE, SuperTAG26 bp0,00002

14 20 bp versus 26 bp Advantages of the SuperTAG Only the 26 bp tag can differentiate between the transcripts ! BLAST-Hit, Mus musculus, Score = 52 CATGGTGGCTCACAACCATC Immunoglobulin kappa chain complex CATGGTGGCTCACAACCATC Tumor necrosis factor (ligand) superfamily, member 10 CATGGTGGCTCACAACCATC Homeodomain leucine zipper-encoding gene CATGGTGGCTCACAACCATC Mannose phosphate isomerase 1, transcript variant bp (MmeI, LongSAGE) 26 bp (Ecop15I, SuperTAG) Tag Quality CATAAC CGTAAT TGTAGATGTAGA TGTATCTGTATC ? ? ? ? ! ! ! !

15 Problem of PCR-introduced BIAS Certain tags are preferentially amplified during PCR biased quantification The Solution: GenXPros bias-proof adapters (patent pending) secure quantification

16 26 bp SuperTAGs can: Serve as specific probes: identification of genomic or cDNA clones Directly be used as highly specific primer for PCR 3- and 5- RACE, in vitro PCR, qRT-PCR: new genes & non-model organisms can be analyzed. Be directly spotted on a microarray for HT analysis 1 Be used for the simultaneous analysis of two or more organisms (pathogen/host) 2 2.Matsumura et al. (2003) PNAS 100: Matsumura et al. (2006) Nature Methods 3: Advantages of the SuperTAG Downstream applications &

17 Digital Gene Expression vs. Microarrays Major Advantages of SuperTAG-DGE versus Microarrays Reliable quantification of the transcriptome: counts vs. semi-quantitative light signal intensities Open architecture platform: any gene detected, novel genes, unexpected transcripts, antisense transcripts No false positives, no cross hybridisation Rare transcripts are exactly quantified Higher dynamic range: log 2 >6 vs. log 2 <3

18 About 80–95% of all mRNA species are present in five or fewer copies per cell. These rare transcripts make up 35–50% of all the mRNAs. SuperTAG-DGE includes rare Transcripts Digital Gene Expression vs. Microarrays

19 SuperSAGE-Analysis: Transcript Frequencies Example: Tags from Mouse Spleen (Mus musculus) More than 75 % rare transcripts: This information is lost on microarrays ! > different transcripts excluding the singletons * > Singletons with distinct matches to the NCBI-DB Only this part is visible for microarrays

20 Comparable data: Exact number for every transcript vs. semiquantitative values (Microarrays, RT-PCR) SuperTAG vs. Micro-arrays

21 2-fold regulation Detection of antisense RNAs Stress-regulation of expression of peroxidase antisense transcripts in Cicer arietinum (chickpea)

22 Normalization of cDNA libraries: Frequent transcripts are strongly reduced cDNA before normalization cDNA after normalization

23 Analysis of normalized cDNA ends: Lower costs, sufficient for genotyping! cDNA before normalisation Normalized cDNA-Ends:

24 RNAseq vs. ST-DGE (SuperSAGE) For the same depth of analysis, about (50-)100 times more sequencing is required Mean transcript size : bp Tag size: ()26 bp 5353 AAAAAAA-3 TTTTTTT-5 cDNA

25 Functional annotation cDNA Ends superTags cDNA Function ? Swissprot, Trembl, NCBI nBLAST BLASTx nBLAST 1.Closest related organism 2.Lesser related organism 3.Lesser related organism 4.Etc. BLASTx

26 References Unravelling the interaction of HCMV with dendritic cells using SuperSAGE M.J. Raftery, E. M. Buchner, H.Matsumura, T.Giese, A. Winkelmann, M. Reuter, R.Terauchi, G.Schönrich and D. H Krüger J Gen Virol (2009), DOI /vir Molecular signatures of apomictic and sexual ovules in the Boechera holboellii complex Timothy F. Sharbel, Marie-Luise Voigt, Jose´ Maria Corral, Thomas Thiel, Alok Varshney, Jochen Kumlehn, Heiko Vogel and Björn Rotter (2009) The Plant Journal, doi: /j X x Long-Short-Long Games in mRNA Identification: The Length Matters Wang. S. M. (2008) Current Pharmaceutical Biotechnology, 9, SuperSAGE: the drought stress-responsive transcriptome of chickpea roots Molina C.M., Rotter B., Horres R., Udupa S., Besser B., Bellarmino L., Baum M., Matsumura H., Terauchi R., Kahl G. and Winter P. (2008) BMC Genomics, 9:553doi: / Spermine signaling plays a significant role in the defense response of Arabidopsis thaliana to cucumber mosaic virus. Mitsuya Y, Takahashi Y, Berberich T, Miyazaki A, Matsumura H, Takahashi H, Terauchi R, Kusano T. (2008) J Plant Physiol. Oct 13. SuperSAGE: a modern platform for genome-wide quantitative transcript profiling. Matsumura H, Krüger DH, Kahl G, Terauchi R. Curr Pharm Biotechnol Oct;9(5): SuperSAGE array: the direct use of 26-base-pair transcript tags in oligonucleotide arrays. Matsumura H, Bin Nasir KH, Yoshida K, Ito A, Kahl G, Kruger DH, Terauchi R. (2006) Nat Methods 3: Gene expression analysis of plant host-pathogen interactions by SuperSAGE. Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P, Kahl G, Reuter M, Kruger DH, Terauchi R Proc Natl Acad Sci U S A. 100:

27 Thank you for your attention ! Our expertise at your demand


Download ppt "GenXPro GmbH, Frankfurt am Main Our expertise at your demand."

Similar presentations


Ads by Google