Presentation is loading. Please wait.

Presentation is loading. Please wait.

GenXPro GmbH, Frankfurt am Main

Similar presentations


Presentation on theme: "GenXPro GmbH, Frankfurt am Main"— Presentation transcript:

1 GenXPro GmbH, Frankfurt am Main
Our expertise at your demand GenXPro GmbH, Frankfurt am Main

2 Our Service Portfolio Digital Gene Expression Service:
from cells/tissues to annotated/BLASTed libraries in one to three month Normalization of cDNA, sequencing and assembly - RNA seq, microRNAs - Taq-Man assays, Real-Time PCR service Identification of SNPs, molecular (genetic) markers Copy number variations (CNVs) - Epigenetics

3 SuperTag Digital Gene Expression Profiling (ST-DGE)
Transcriptome Analysis & Gene Discovery SuperTag Digital Gene Expression Profiling (ST-DGE) An Improved version of SuperSAGE, applying second generation sequencing and a bias free PCR technology for optimal tag-to-gene association and quantification. Name, Firma, Ziele, Geschichte

4 Digital Gene expression Profiling Principle
What Gene is expressed and how often ? Anchoring Enzyme Tagging Enzyme Streptavidin-Beads 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ Sequencing of Millions of 26 bp SuperTags Counting, BLAST

5 Digital Gene expression Profiling
Principle Streptavidin-Beads 1.Digestion with Anchoring Enzyme 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’

6 Digital Gene Expression Profiling Principle
What Gene is expressed and how often ? Streptavidin-Beads 1.Digestion with Anchoring Enzyme 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’

7 Digital Gene Expression Profiling Principle
What Gene is expressed and how often ? Streptavidin-Beads 1.Digestion with Anchoring Enzyme 2. First Linker Ligation Linker 1 cDNA AAAAAAA-3’ TTTTTTT-5’ 3. Digestion with Tagging Enzyme Linker 1 cDNA AAAAAAA-3’ TTTTTTT-5’ 4. Recovery of Linker-Tags Linker 1 cDNA AAAAAAA-3’ TTTTTTT-5’ Linker 1 cDNA AAAAAAA-3’ TTTTTTT-5’ Highly specific 26bp “SuperTags“

8 Digital Gene Expression Profiling Principle
What Gene is expressed and how often ? Streptavidin-Beads 1.Digestion with Anchoring Enzyme Linker 1 Linker 2 AAAAAAA-3’ TTTTTTT-5’ 2. First Linker Ligation 3. Digestion with Tagging Enzyme Linker 1 AAAAAAA-3’ TTTTTTT-5’ 4. Recovery of Linker-Tags 5. Second Linker Ligation Linker 1 AAAAAAA-3’ TTTTTTT-5’ 5. PCR Linker 1 AAAAAAA-3’ TTTTTTT-5’

9 Digital Gene Expression Profiling Principle
What Gene is expressed and how often ? Streptavidin-Beads 1.Digestion with Anchoring Enzyme Linker 1 Linker 2 AAAAAAA-3’ TTTTTTT-5’ 2. First Linker Ligation Linker 1 Linker 2 Linker 1 Linker 2 3. Digestion with Tagging Enzyme Linker 1 Linker 2 AAAAAAA-3’ TTTTTTT-5’ 4. Recovery of Linker-Tags Linker 1 Linker 2 Linker 1 Linker 2 Sequencing of Millions of Tags 5. Second Linker Ligation Linker 1 Linker 2 AAAAAAA-3’ TTTTTTT-5’ Linker 1 Linker 2 5. PCR Linker 1 Linker 2 6. Next-Generation Sequencing Linker 1 Linker 2 AAAAAAA-3’ TTTTTTT-5’ Linker 1 Linker 2 7. Counting of Tags, Bioinformatics Linker 1 Linker 2 Counting, BLAST

10 Digital Gene expression Profiling
Principle Anchoring Enzyme Tagging Enzyme Streptavidin-Beads 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ 5’ 3’ cDNA AAAAAAA-3’ TTTTTTT-5’ Sequencing of Millions of 26 bp SuperTags Counting, BLAST

11 Quality of digital gene expression data depends on:
Digital Gene Expression Profiling Quality Quality of digital gene expression data depends on: 1. Quality of the Tag (what gene is expressed?) 2. Quantity of the Tags (how often is the gene expressed?)

12 The Tagging Enzyme determines Quality of Tags:
Tag-Quality The Tagging Enzyme determines Quality of Tags: LongSAGE, other DGE platforms MmeI: 18-20 bp 5’- GGGACNNNNNNNNNNNNNNNNNNNN -3’ 3’- CCCTGNNNNNNNNNNNNNNNNNN -5’ SuperSAGE, SuperTAG-DGE EcoP15I : bp (=SuperTAG)‏ 5’-CAGCAGNNNNNNNNNNNNNNNNNNNNNNNN -3’ 3’-GTCGTCNNNNNNNNNNNNNNNNNNNNNNNNNN -5’

13 SuperTAGs allow unequivocal Identification of the corresponding Gene
Tag Quality What gene? SuperTAGs allow unequivocal Identification of the corresponding Gene Enzyme Platform Tag-Size e-value BsmFI-Tag SAGE 14 bp 105 MmeI-Tag LongSAGE, Other platforms 18-20 bp 0,34 EcoP15I-Tag SuperSAGE, SuperTAG 26 bp 0,00002

14 Advantages of the SuperTAG
Tag Quality Advantages of the SuperTAG 20 bp versus 26 bp 18-20bp (MmeI, LongSAGE) BLAST-Hit , Mus musculus, Score = 52 CATGGTGGCTCACAACCATC Immunoglobulin kappa chain complex Tumor necrosis factor (ligand) superfamily, member 10 Homeodomain leucine zipper-encoding gene Mannose phosphate isomerase 1, transcript variant 4 26 bp (Ecop15I, SuperTAG) CATAAC CGTAAT TGTAGA TGTATC ? ! Only the 26 bp tag can differentiate between the transcripts !

15 Problem of PCR-introduced BIAS
Certain tags are preferentially amplified during PCR biased quantification The Solution: GenXPro’s bias-proof adapters (patent pending) secure quantification

16 Downstream applications &
Advantages of the SuperTAG 26 bp SuperTAGs can: Directly be used as highly specific primer for PCR 3‘- and 5‘- RACE, in vitro PCR, qRT-PCR: new genes & non-model organisms can be analyzed. Serve as specific probes: identification of genomic or cDNA clones Be directly spotted on a microarray for HT analysis1 Be used for the simultaneous analysis of two or more organisms (pathogen/host)2 Matsumura et al. (2006) Nature Methods 3: 2. Matsumura et al. (2003) PNAS 100:

17 Digital Gene Expression vs. Microarrays
Major Advantages of SuperTAG-DGE versus Microarrays No false positives, no cross hybridisation Open architecture platform: any gene detected, novel genes, unexpected transcripts, antisense transcripts Reliable quantification of the transcriptome: counts vs. semi-quantitative light signal intensities Higher dynamic range: log2>6 vs. log2<3 Rare transcripts are exactly quantified

18 Digital Gene Expression vs. Microarrays
SuperTAG-DGE includes rare Transcripts About 80–95% of all mRNA species are present in five or fewer copies per cell. These rare transcripts make up 35–50% of all the mRNAs.

19 SuperSAGE-Analysis: Transcript Frequencies
Example: Tags from Mouse Spleen (Mus musculus) More than 75 % rare transcripts: This information is lost on microarrays ! Only this part is visible for microarrays Specific tag for each transcript, enzymatically obtained > different transcripts excluding the singletons * > Singletons with distinct matches to the NCBI-DB

20 SuperTAG vs. Micro-arrays
Comparable data: Exact number for every transcript vs. semiquantitative values (Microarrays, RT-PCR)‏

21 Detection of antisense RNAs
Stress-regulation of expression of peroxidase antisense transcripts in Cicer arietinum (chickpea) 2-fold regulation

22 cDNA before normalization cDNA after normalization
Normalization of cDNA libraries: Frequent transcripts are strongly reduced cDNA before normalization cDNA after normalization

23 Analysis of normalized cDNA ends:
Lower costs, sufficient for genotyping! cDNA before normalisation Normalized cDNA-Ends:

24 RNAseq vs. ST-DGE (SuperSAGE)
Mean transcript size : bp Tag size: ( ) 26 bp 5’ 3’ AAAAAAA-3’ TTTTTTT-5’ cDNA For the same depth of analysis, about (50-)100 times more sequencing is required

25 Functional annotation
superTags cDNA Ends cDNA nBLAST nBLAST nBLAST nBLAST BLASTx BLASTx Closest related organism Lesser related organism Etc. Swissprot, Trembl, NCBI

26 References Unravelling the interaction of HCMV with dendritic cells using SuperSAGE M.J. Raftery, E. M. Buchner, H.Matsumura, T.Giese, A. Winkelmann, M. Reuter, R.Terauchi, G.Schönrich and D. H Krüger J  Gen Virol (2009), DOI  /vir Molecular signatures of apomictic and sexual ovules in the Boechera holboellii complex Timothy F. Sharbel, Marie-Luise Voigt, Jose´ Maria Corral, Thomas Thiel, Alok Varshney, Jochen Kumlehn, Heiko Vogel and Björn Rotter (2009) The Plant Journal, doi: /j X x Long-Short-Long Games in mRNA Identification: The Length Matters Wang . S. M. (2008) Current Pharmaceutical Biotechnology, 9, SuperSAGE: the drought stress-responsive transcriptome of chickpea roots Molina C.M., Rotter B., Horres R., Udupa S., Besser B., Bellarmino L., Baum M., Matsumura H., Terauchi R., Kahl G. and Winter P. (2008) BMC Genomics , 9:553doi: / Spermine signaling plays a significant role in the defense response of Arabidopsis thaliana to cucumber mosaic virus. Mitsuya Y, Takahashi Y, Berberich T, Miyazaki A, Matsumura H, Takahashi H, Terauchi R, Kusano T. (2008) J Plant Physiol. Oct 13. SuperSAGE: a modern platform for genome-wide quantitative transcript profiling. Matsumura H, Krüger DH, Kahl G, Terauchi R. Curr Pharm Biotechnol Oct;9(5): SuperSAGE array: the direct use of 26-base-pair transcript tags in oligonucleotide arrays. Matsumura H, Bin Nasir KH, Yoshida K, Ito A, Kahl G, Kruger DH, Terauchi R. (2006) Nat Methods 3: Gene expression analysis of plant host-pathogen interactions by SuperSAGE. Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P, Kahl G, Reuter M, Kruger DH, Terauchi R Proc Natl Acad Sci U S A. 100:

27 Thank you for your attention !
Our expertise at your demand


Download ppt "GenXPro GmbH, Frankfurt am Main"

Similar presentations


Ads by Google