1. cbio course, spring 2005, Hebrew University Computational Methods In Molecular Biology CS-67693, Spring 2005 School of Computer Science & Engineering Hebrew University, Jerusalem

2. cbio course, spring 2005, Hebrew University Class 1: Introduction

3. cbio course, spring 2005, Hebrew University Introduction u What is Comp. Bio.? Why is it great? u What are the aims and basic concepts of this course u High level biological review: give basic bio background and motivation for tasks handled in the course u Administration…

4. cbio course, spring 2005, Hebrew University The Cell

5. cbio course, spring 2005, Hebrew University Example: Tissues in Stomach

6. cbio course, spring 2005, Hebrew University DNA Components Four nucleotide types: u Adenine u Guanine u Cytosine u Thymine Hydrogen bonds: u A-T u C-G

7. cbio course, spring 2005, Hebrew University The Double Helix Source: Alberts et al

8. cbio course, spring 2005, Hebrew University DNA Organization Source: Alberts et al

9. cbio course, spring 2005, Hebrew University Genome Sizes u E.Coli (bacteria)4.6 x 10 6 bases u Yeast (simple fungi) 15 x 10 6 bases u Smallest human chromosome 50 x 10 6 bases u Entire human genome 3 x 10 9 bases

10. cbio course, spring 2005, Hebrew University Related Computational Tasks u Need a way to reconstruct DNA sequence from fragments – major contribution of comp. bio. ! u Related: sequence comparison, sequence alignment

11. cbio course, spring 2005, Hebrew University DNA Duplication Source: Mathews & van Holde

12. cbio course, spring 2005, Hebrew University Genes The DNA strings include: u Coding regions (“genes”)  E. coli has ~4,000 genes  Yeast has ~6,000 genes  C. Elegans has ~13,000 genes  Humans have ~32,000 genes u Control regions  These typically are adjacent to the genes  They determine when a gene should be expressed u “Junk” DNA (unknown function)

13. cbio course, spring 2005, Hebrew University The Tree of Life Source: Alberts et al

14. cbio course, spring 2005, Hebrew University Evolution u Related organisms have similar DNA  Similarity in sequences of proteins  Similarity in organization of genes along the chromosomes u Evolution plays a major role in biology  Many mechanisms are shared across a wide range of organisms (e.g. orthologes)  During the course of evolution existing components are adapted for new functions (e.g paraloges)

15. cbio course, spring 2005, Hebrew University Evolution Evolution of new organisms is driven by u Diversity  Different individuals carry different variants of the same basic blue print u Mutations  The DNA sequence can be changed due to single base changes, deletion/insertion of DNA segments, etc. u Selection bias

16. cbio course, spring 2005, Hebrew University Related Computational Tasks u Phylogeny – not just theory!:  Rebuild the tree of life…  Infer relations between genes/pathways etc. across species  Learn models for changes and development  Major benefit: exploit the information we do have/observe to infer about the systems on which we have very little knowledge and observations….

17. cbio course, spring 2005, Hebrew University How Do Genes Code for Proteins? Transcription RNA Translation Protein DNA

18. cbio course, spring 2005, Hebrew University Transcription u Coding sequences can be transcribed to RNA u RNA nucleotides:  Similar to DNA, slightly different backbone  Uracil (U) instead of Thymine (T) Source: Mathews & van Holde

19. cbio course, spring 2005, Hebrew University RNA Editing

20. cbio course, spring 2005, Hebrew University Translation

21. cbio course, spring 2005, Hebrew University Translation u The ribosome attaches to the mRNA at a translation initiation site u Then ribosome moves along the mRNA sequence and in the process constructs a poly-peptide u When the ribosome encounters a stop signal, it releases the mRNA. The construct poly-peptide is released, and folds into a protein. u Translation is mediated by the ribosome u Ribosome is a complex of protein & rRNA molecules

22. cbio course, spring 2005, Hebrew University Translation Source: Alberts et al

23. cbio course, spring 2005, Hebrew University Translation Source: Alberts et al

24. cbio course, spring 2005, Hebrew University Translation Source: Alberts et al

25. cbio course, spring 2005, Hebrew University Translation Source: Alberts et al

26. cbio course, spring 2005, Hebrew University Translation Source: Alberts et al

27. cbio course, spring 2005, Hebrew University Genetic Code

28. cbio course, spring 2005, Hebrew University Transcription RNA Translation Protein DNA The Central Dogma Genes Experiments

29. cbio course, spring 2005, Hebrew University TF TFs Basal Promoter mRNA Gene 5’5’ 3’3’ Transcription start site 3’3’ 5’5’ RNA polymerase II 5’5’ Eukaryotic Transcription Regulation “Classical Model” u Composition of promoter region determines rate of transcription initiation u Combinations of TFs control the transcription of gene sets under specific conditions Genes TF

30. cbio course, spring 2005, Hebrew University From Data to Model >YKL112W Chr 11 ATGGACAAATTAGTCGTGAATTATTATGAATACAAGCACCCTAT AATTAATAAAGACCTGGCCATTGGAGCCCATGGAGGCAAAAA ATTTCCCACCTTGGGTGCTTGGTATGATGTAATTAATGAGTAC GAATTTCAGACGCGTTGCCCTATTATTTTAAAGAATTCGCATA GGAACAAACATTTTACATTTGCCTGTCATTTGAAAAACTGTCCA TTTAAAGTCTTGCTAAGCTATGCTGGCAATGCTGCATCCTCAG AAACCTCATCTCCTTCTGCAAATAATAATACCAACCCTCCGGG TACTCCTGATCATATTCATCATCATAGCAACAACATGAACAACG AGGACAATGATAATAACAATGGCAGTAATAATAAGGTTAGCAA TGACAGTAAACTTGACTTCGTTACTGATGATCTTGAATACCATC TGGCGAACACTCATCCGGACGACACCAATGACAAAGTGGAGT CGAGAAGCAATGAGGTGAATGGGAACAATGACGATGATGCTG ATGCCAACAACATTTTTAAACAGCAAGGTGTTACTATCAAGAA CGACACTGAAGATGATTCGATAAATAAGGCCTCTAT

31. cbio course, spring 2005, Hebrew University Many Related Computational Tasks… u Information is in the code book →:  How alternative splicing is determined and where?  Build models for regulation of genes at different levels of complexity  Relate genotype and phenotype: What are the expression patterns of some disease? How do they relate to sequence? What model can explain the observations? Can we predict phenomenon based on our models?

32. cbio course, spring 2005, Hebrew University Who came first? u Chicken or egg?  Egg u DNA or Protein?  RNA… u Thomas Cech & Sidney Altman ( 80’s !):  RNA as an “independent” molecule  Probably more close to the ancient “source”

33. cbio course, spring 2005, Hebrew University RNA roles u Messenger RNA (mRNA)  Encodes protein sequences u Transfer RNA (tRNA)  Adaptor between mRNA molecules and amino- acids (protein building blocks) u Ribosomal RNA (rRNA)  Part of the ribosome, a machine for translating mRNA to proteins u...

34. cbio course, spring 2005, Hebrew University Transfer RNA Anticodon: u matches a codon (triplet of mRNA nucleotides) Attachment site: u matches a specific amino-acid

35. cbio course, spring 2005, Hebrew University Related Computational Tasks u RNA secondary structure prediction:  based on CFG and CM u RNA coding area prediction u …

36. cbio course, spring 2005, Hebrew University RNA Editing Source: Mathews & van Holde

37. cbio course, spring 2005, Hebrew University Translation

38. cbio course, spring 2005, Hebrew University How do Proteins Perform their Rules? u Protein interact in various ways u Change conformations, conformations → function u Major Issues:  Their “active”/functional areas which interact  Their 3D structure

39. cbio course, spring 2005, Hebrew University Protein Structure u Proteins are poly- peptides of 70-3000 amino-acids u This structure is (mostly) determined by the sequence of amino-acids that make up the protein

40. cbio course, spring 2005, Hebrew University Protein Structure

41. cbio course, spring 2005, Hebrew University Related Computational Tasks u Protein 2D, 3D structure prediction u Identify sequence motifs/domains in proteins  Sequence similarity vs. functional similarity

42. cbio course, spring 2005, Hebrew University Course Goals u Review current tasks posed by modern molecular biology u Review and experiment with some of the tools/solutions currently found (e.g. BLAST, clustalw) u Gain some tools to handle such problems:  Dynamic programming  Probabilistic graphical models:  MM,HMM,CM,Trees  Representation, what principles justify them, Learning, Inference  Statistic tools: how to measure our confidence in our results?

43. cbio course, spring 2005, Hebrew University Course Goals u Computational tools in molecular biology: u We will cover computational tasks that are posed by modern molecular biology u We will discuss the biological motivation and setup for these tasks u We will understand the the kinds of solutions exist and what principles justify them

44. cbio course, spring 2005, Hebrew University Course’s Main Point

45. cbio course, spring 2005, Hebrew University Course’s Main Point Learn to do: Define the problem → Find comp. solution Four Aspects: Biological  What is the task? Algorithmic  How to perform the task at hand efficiently? Learning  How to adapt parameters of the task form examples Statistics  How to differentiate true phenomena from artifacts

46. cbio course, spring 2005, Hebrew University Example: Sequence Comparison Biological  Evolution preserves sequences, thus similar genes might have similar function Algorithmic  Consider all ways to “align” one sequence against another Learning  How do we define “similar” sequences? Use examples to define similarity Statistics  When we compare to ~10 6 sequences, what is a random match and what is true one

47. cbio course, spring 2005, Hebrew University Topics I Dealing with DNA/Protein sequences: u Genome projects and how sequences are found u Finding similar sequences u Models of sequences: Hidden Markov Models u Transcription regulation u Protein Families u Gene finding

48. cbio course, spring 2005, Hebrew University Topics II Gene Expression: u Genome-wide expression patterns u Data organization: clustering u Reconstructing transcription regulation u Recognizing and classifying cancers

49. cbio course, spring 2005, Hebrew University Topics III Models of genetic change: u Long term: evolutionary changes among species u Reconstructing evolutionary trees from current day sequences u Short term: genetic variations in a population u Finding genes by linkage and association

50. cbio course, spring 2005, Hebrew University Topics IV Protein World: u How proteins fold - secondary & tertiary structure u How to predict protein folds from sequences data alone u How to analyze proteins changes from raw experimental measurements (MassSpec) u 2D gels

51. cbio course, spring 2005, Hebrew University Class Structure u 2 weekly meeting  Mondays 16-18 (Levin 8), Wednesdays 10-12 (Kaplan) Grade: u Homework assignments: ~50% of the final grade. There will be up to seven homework assignments. These assignments will include theoretical problems, using bioinformatics tools and programming. u Final home assignment: ~20% of the final grade. u Final test: ~30% of the grade. u Class participation: A 5% bonus grade for students who actively participate in discussions during classes u Possible: oral presentation of any exercise to define grade!

52. cbio course, spring 2005, Hebrew University Exercises & Handouts u Check regularly http://www.cs.huji.ac.il/~cbio