1. 基因與蛋白質資料庫 阮雪芬 Nov 20 & 27, 2002 NTU

2. Index Genome Sequence searching Cutting site for a specific sequence Restriction Mapper REBASE REBsite NEB cutter v1.0 DARWIN Sequence Alignment NCBI BLAST Pairwise BLAST Search for conserved domains ORF Finder BGSS Proteome Protein primary structure Amino acid and atomic composition Computing pI and MW Sequence searching Sequence alignment DNA translate to protein Protein-protein interaction on the web YPLMD GeneScape YIPD BIOCARTA

3. Outline Introduction to genomics Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding Genomics

4. Ribose and Deoxyribose

5. Backbone of DNA and RNA

6. Purines and Pyrimidines

7. Watson-Crick Base Pairs

9. Watson-Crick Model of Double Helical DNA

10. Biochemical Context of Genomics and Proteomics DNA mRNA Proteins Cell functions Genome “ Genomics ” Proteome “ Proteomics ”

11. DNA 和蛋白質合成的地方 DNA Proteins Sugar Chain cytoplasm

12. Genome Gene + Chromosome Genome

13. Gene Sequence Searching Accession Number Gene Sequence

14. Gene Sequence Searching AA046701 AA069414 AA070289 AA446013 AA425102 http://www.ncbi.nlm.nih.gov/UniGene/

15. Gene Sequence Searching

17. GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC

18. Cutting Site for a Specific Sequence Sequence Cut by Restriction Enzymes 1.RestrictionMapper 2.REBASE 3.DARWIN

19. Cutting Site for a Specific Sequence RestrictionMapper http://www.restrictionmapper.org

20. RestrictionMapper

22. REBASE Rebase.neb.com/rebase.html

27. DARWIN http://darwin.bio.geneseo.edu/~yin/WebGene/ RE.html

28. Sequence Alignment Input Query Amino Acid Sequence DNA Sequence Blastptblastn blastn blastxtblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database

29. Pairwise BLAST

32. BLAST NCBI: http://www.ncbi.nlm.nih.gov/

35. Copy Sequence

39. Search for Conserved Domains

42. ORF Finder (Open Reading Frame Finder) http://www.ncbi.nlm.nih.gov/gorf/

45. BGSS (Gene Function Search System) AA046701 AA069414 AA070289 AA446013 AA425102 http://gate.sinica.edu.tw:8900/perl/genequery.pl

46. BGSS

47. Outline Introduction to proteomics Primary Structure Analysis Protein Sequence Searching Protein Sequence Alignment DNA Translate to Protein Protein-protein Interactions Useful Bio-websites Proteomics

48. What Is Proteomics ?

49. Proteomics Protein +Genome  Proteome Proteome  Proteomics

50. How Proteomics Can Help Drug Development

51. Definitions of Proteomics First coined in 1995 Be defined as the large-scale characterization of the entire protein complement of a cell line, tissue, or organism. Goal: -To obtain a more global and integrated view of biology by studying all the proteins of a cell rather than each one individually.

52. Proteomics Origins In 1975, the introduction of the 2D gel by O’Farrell who began mapping proteins from E. coli. The first major technology to emerge for the identification of proteins was the sequencing of proteins by Edman degradation  picomole MS technology has replaced Edman degradation to identify proteins  femtomole

53. Types of Proteomics and Their Applications to Biology

54. Two-dimensional Gel Approach Nature 2000, 405, 837-846

55. Standard Proteome Analysis by 2DE-MS Current Opinion in Chemical Biology 2000, 4:489–494 Mass Fingerprint Searching in http://www.expas ych/tools/peptide nt.html

56. Primary Structure Analysis Object: To compute the characters of proteins. -Amino acid composition -Atomic composition -pI -Molecular weight

57. Amino Acid & Atomic Composition ProtParam

58. Amino Acid & Atomic Composition http://www.expasy.ch/tools/protparam.html

59. Amino Acid & Atomic Composition Amino Acid Composition Atomic Composition

60. Computing pI and MW

62. MW pIpI

63. Protein Sequence Searching P02571

64. Protein Sequence Searching

65. Sequence Alignment Input Query Amino Acid Sequence DNA Sequence Blastptblastn blastn blastxtblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database

66. Sequence Alignment http://www.expasy.ch/

67. Sequence Alignment

71. Similarity is very low No similarity

72. The Information Stored in Genes Is Expressed by a Multistage Process

73. The Genetic Code Is Degenerate

74. DNA Translate to Protein http://www.expasy.ch/tools/

75. DNA Translate to Protein DNA Protein

76. DNA Translate to Protein

77. DNA sequence

78. DNA Translate to Protein

79. Protein-protein Interactions on the Web Yeast http://depts.washington.edu/sfields/yplm/data/index.html http://portal.curagen.com http://mips.gsf.de/proj/yeast/CYGD/interaction/ http://www.pnas.org/cgi/content/full/97/3/1143/DC1 http://dip.doe-mbi.ucla.edu/ http://genome.c.kanazawa-u.ac.jp/Y2H C. Elegans http://cancerbiology.dfci.harvard.edu/cancerbiology/ResLabs/Vidal/ H. Pylori http://pim/hybrigenics.com Drosophila http://gifts.univ-mrs.fr/FlyNets/Flynets_home_page.html

80. Yeast Protein Linkage Map Data New protein-protein interactions in yeast Stanley Fields Lab http://depts.washington.edu/sfields/yplm/data List of interactions with links to YPD

81. Yeast Protein Linkage Map Data

82. GeneScape PathwayCalling: Protein interaction and pathway Analysis http://portal.curagen.com PATHCALLING YEAST DATABASE

83. GeneScape

85. GeneScapeMIPS Currently about 9750 protein-protein-interactions (8250 physical and 1500 genetic) are annotated.

86. Yeast Interacting Proteins Database (YIPD) http://genome.c.kanazawa-u.ac.jp/ Yeast Interacting Proteins Database

87. Genetic Network Visualization System Workbench System for Support of Gene Regulatory Network Construction YIPD

88. Java Applet YIPD

89. GUI System Help YIPD

90. Pathway Software BIOCARTA http://biocarta.com/ Browse all pathway

91. Pathway Software BIOCARTA

92. Pathway Result 1: Enolase Glycolysis Pyruvate Acetyl-CoA ethanol lactate Cancer cells BIOCARTA

93. Pathway Result 2 : Retinoic Acid Receptor RXR-alpha BIOCARTA

94. Useful BioWeb Site nameURLInformation available MOWSE http://srs.hgmp.mrc.ac.uk/cgi-bin/mowsePeptide mass mapping and sequencing ProFoundhttp://prowl.rockefeller.edu/cgi- bin/ProFound Peptide mass mapping and sequencing PeptIdenthttp://www.expasy.ch/tools/peptident.Peptide mass mapping and sequencing PepSeahttp://195.41.108.38/PepSeaIntro.htmlPeptide mass mapping and sequencing MASCOThttp://www.matrixscience.com/Peptide mass mapping and sequencing PepFraghttp://www.proteometrics.com/Peptide mass mapping and sequencing Protein Prospectorhttp://prospector.ucsf.edu/Peptide mass mapping and sequencing FindModhttp://www.expasy.ch/tools/findmod/Posttranslational modification SEAQUESThttp://fields.scripps.edu/sequest/Uninterpreted MS/MS searching FASTA Search Programs http://fasta.bioch.virginia.edu/Protein and nucleotide database searching Cleaved Radioactivity of Phosphopeptides http://fasta.bioch.virginia.edu/crpProtein phosphorylation site mapping