1. Catching RIP in the act. Part I: A PCR assay to detect DNA methylation Paul Donegan Freitag Lab Biochemistry and Biophysics Department Oregon State University

2. Background MUTAGENESIS: Mutations of base pairs in genetic material –Induced by UV, X-ray, viruses, etc. –Spontaneous occurrence –triggers DNA repair Hypermutagenesis –Induced and controlled by cells –Not spontaneous --AID deaminase --ApoBec (HIV) --RIP

3. R I P RIP = Repeat Induced Point Mutation Genomic defense mechanism –Silences repetitive DNA (no expression) Targets duplicated DNA segments –linked or unlinked sequences Induces C to T transition mutations RIP triggered by repeated sequence Identical Sequences Mutated Sequences C to T point mutations induced by RIP GCATATTAGTTATGTTTAGCGCATTCTAGTATATCAGTTATGTTCAGTGCACTTTA GCATATCAGTCATGCTCAGCGCACCTA

4. Relevance We are interested in RIP because we want to: –gain insights into evolutionary mechanisms that shape genomes. –understand genome defense mechanisms and mutagenesis.

5. Summer Research Objective To differentiate between two possible molecular mechanism that can explain RIP Neurospora crassa Rosette of sexual spores, nuclei labelled with GFP

6. Possible Mechanisms for C to T Mutations caused by RIP (1) Methylation by a specific cytosine DNA methyltransferase, followed by deamination Methyl Group Donor- S-adenosylmethionine (SAM) C C Me T H3CH3C METHYLATIONDEAMINATION

7. Possible Mechanisms for C to T Mutations caused by RIP (2) Cytosine is never methylated but instead deaminated to uracil, which will be replaced with thymine by DNA replication or repair z C U Enz DEAMINATION Intermediate

8. Image from: Shiu et al. (2001) Cell RIP timeline RIP occurs during the sexual cycle RIP occurs after fertilization but before karyogamy. ~10 mitotic divisions while RIP can occur. FERTILIZATION KARYOGAMY RIP ZONE!

9. DNA was extracted during the expected RIP timeframe Methylation of interest should occur between fertilization and karyogamy (nuclear fusion). 0 1 2 3 4 5 6 7 DAY RIP ZONE (between fertilization and karyogamy) Methylation Assay Timeline Controls Days of Interest

10. PCR after Digest Methylation-sensitive vs. methylation-insensitive restriction enzymes: Sau3AI tests for cytosine methylation, based on the presence or absence of bands Methylated site Digest PCR GATC me Digest with Sau3AI DpnII is not sensitive to cytosine methylation: -cuts regardless -control (never amplifies) Unmethylated site Bands cannot be amplified when site is cut GATC

11. RFP ‘tdimerRed’ has two identical segments that trigger RIP integrated into the Neurospora genome (not in WT) here, we look for DNA methylation induced by RIP EVIDENCE OF METHYLATION SUGGESTS MECHANISM 1 Mutations in the RFP region

12. RFP amplification Primers 1+3 (A) and 2+3 (B) amplified RFP bands only from RFP + strain Primers 5+6 (C) amplified control gene (hpo) * RFP region 1 23 hpo 5 6 * Bands from 5/6 appear in all genomic DNA’s but are absent in both plasmids Genomic DNA (Neurospora)Plasmid DNA wild type Primers: A B C A B C * RFP - RFP + * * * * * * * * ExperimentalControl RFP + * * Primers: A B C A B C ** *

13. Digests of RFP fragments Digestion of previously amplified segments -both restriction enzymes should cut the segments roughly in half Each enzyme cut each segment roughly in half (two unique bands, similar in size) Suggests that the correct band was amplified * * * * * 1 23 [Amplified region (1/3 or 2/3)] Cutting sites- 1 2 [RFP Region] [Expected Bands from Digest] EXPECTATION 1 2 Restriction Enzyme 1Restriction Enzyme 2

14. BUT: Assay never worked with positive controls of methylated DNA 25 cycles 28 cycles 31 cycles  G S D hpo G = genomic DNA, no digest S = Sau3AI, C-methylation sensitive D = DpnII, C-methylation insensitive Positive control: Methylated region Negative control: Unmethylated region Expected band in S lane, but no band in D lane Expected no band in S or D lane

15. Catching RIP in the act. Part II: Tagging of duplicated DNA with fluorescent DNA binding proteins

16. Goals Tag DNA of Neurospora crassa with fluorescent proteins: –to visualize pairing of duplications during RIP; –to track chromosome territory movement (e.g., centromeres, telomeres, nucleolar DNA, specific genes) –to track movements of DNA binding proteins from nucleus to nucleus –to target enzymes to specific regions on chromosomes

17. Protein tags Tagging with RFP or GFP Specific DNA binding proteins recognize target sequences (binding sites, BS). Tag = translational fusion of a DNA binding domain (DBD) to RFP or GFP. Binding sites recruit DBD-GFP or DBD-RFP fusion; co-localization = yellow. GFP RFP BS DBD BS DBD DNA Protein During RIP GFP RFP GFP RFP GFP RFP GFP RFP

18. Construction of protein tags 3 Transformed E. coli 4 Purified plamids, digested DNA and confirmed correct plasmids 5 Linearized plasmid and transformed into Neurospora his-3 mutant 1 Amplified DBD from Aspergillus AflR and AlcR by PCR 2 Generated translational fusions by cloning into gfp and rfp plasmids 6 Selected His + Neurospora transformants that showed fluorescence AlcR-RFPAflR-GFP Fusion proteins localized in nuclei

19. Construction of DNA binding sites 2 Binding site: DNA sequences specifically recognized by AflR or AlcR AflR: TCGNNNNNCGA AlcR: GCGGRRCCGC Need 200+ copies of recognized sequence to bind enough fluorescent protein for visibility.

20. Summary 1 PCR assay: Did not work in many attempts. We need a new approach. 2 DNA tagging: The protein tags are expressed, binding sites still needed.

21. Acknowledgements HHMI (Howard Hughes Medical Institute) URISC (Undergraduate Research, Innovation, Scholarship & Creativity) Kevin Ahern Michael Freitag Kristina Smith Freitag Lab