Presentation is loading. Please wait.

Presentation is loading. Please wait.

Trehalose and carbohydrate metabolism of L. bicolor A. Deveau P. Frey-Klett, J.Garbaye, F. Martin et al. UMR INRA-UHP 1136 Interactions arbres micro-organismes.

Similar presentations


Presentation on theme: "Trehalose and carbohydrate metabolism of L. bicolor A. Deveau P. Frey-Klett, J.Garbaye, F. Martin et al. UMR INRA-UHP 1136 Interactions arbres micro-organismes."— Presentation transcript:

1 Trehalose and carbohydrate metabolism of L. bicolor A. Deveau P. Frey-Klett, J.Garbaye, F. Martin et al. UMR INRA-UHP 1136 Interactions arbres micro-organismes UFR 110 © INRA

2 Carbohydrate metabolism KEGG Pathway database glycolysis and TCA cycle pentose phosphate pathway malate synthesis trehalose, glycogen metabolism Complete pathways: Uncomplete pathways: mannose (mannose-1-phosphate guanylyltransferase …) mannitol F-6-P Mannose-6-P Mannitol Mannitol-1-PF-6-P Phosphomannose isomerase Mannose-6-P reductase Mannitol-1-P-phosphatase Mannitol dehydrogenase http://www.genome.jp/kegg/pathway/map/map01110.html Trehalose and Glycogen metbolism

3 The trehalose in ectomycorrhizal fungi glucose fructose glucose fructose sucrose fructose glucose + F6P glycogen trehalose mannitol glycolysis plant cortical cell fungal hyphae apoplast G6P CH 2 OHCH 2 OH* Main roles:Main roles: Storage sugar – supplies of endogenous carbon Stress protectant by stabilization of cellular membranes and proteins (freezing, dessication, growth restriction) A signal molecule photosynthesis transport

4 The trehalose in ectomycorrhizal fungi Involved in interactions between mycorrhization helper bacteria and Laccaria bicolor ? Strongly accumulated in Laccaria hyphae L. Bicolor hyphae Pseudomonas fluorescens trehalose Bacterial effect on presymbiotic growth and survival of the fungus Chemiotactism Improvement of bacterial survival

5 Tsl 1 Trehalose 6-P Trehalose UDP-Glucose Glucose 6-P Glucose 1-P Pi glycogen metabolism glycolyse Glucose Pi Hxk 1 Hxk 2 Ugp 1 Pgm Tps 1 Tps 2 GlucoseTrehalose Tre 2 TP ? extracellular intracellular vacuolar storage Glucose Tre 1 TP The putative metabolism of trehalose in L.bicolor

6 TPS3 Tsl 1 Trehalose 6-P Trehalose UDP-Glucose Glucose 6-P Glucose 1-P Pi glycogen metabolism glycolyse Glucose Pi Hxk 1 Hxk 2 Ugp 1 Pgm Tps 1 Tps 2 GlucoseTrehalose Tre 2 TP ? extracellular intracellular vacuolar storage Glucose Tre 1 TP Specificities of the L. bicolor metabolism Trehalose phosphorylase C. neoformans S. cerevisiae trehalose transporter

7 Genes structure : Feature Gene length (bp) Coding size (aa) Exons number per gene Mean exon size (bp) Mean intron size (bp) 2076 Glk1 Notes : The genes are scattered on 9 different scaffolds. TPS1 and Tre2 on the 11th scaffold, separated by 200 000 bp. Two categories of gene structure : high similarity with Phanerochaete gene structure vs low similarity Variable intron size Glk2 UGP1PGMTPS1 TPS2TSL1Tre1Tre 2 TP 227620401968 1836374932143063 2747 2851 479484523 570 511957999727 756 738 13121056 14 9 17 9 13 117 53 128 252 60 205 68 256 61 365 65 170 53 157 5273 123 P. chrysosporum 342 69 2406 502 11 132 90 2127 516 12 129 53 1864 566 4 424 55 2685 783 7 56 324 2532 667 8 75 3540 869 9 274 117 1803 526 5 303 56 2425 678 9 367 49 - - - - - 1849 474 9 176 53 220

8 Bases composition of « large introns » (> 70 bp) High poly T content High poly T content No identity with transposons sequences from Genebank No identity with transposons sequences from Genebank Intron n° 3 of TSL1 (93 bp) GTAAGTTTTTTTTGCTATCTTTTTTTTGTTTTTTTTTGTTTTTGTTTTTGTTT TTTTGTT TGTTTGGGAGATGGGTGCTAATGATGTTTTTAG Intron n° 8 of TSL1 (100 bp) GTTTAGGACCTCCGCTTTTTTTCTCTGCGGACATTGATCGCTGCTCTTTCT TTTATTCTC CGTCTCCCGTTTGTTTTCTTGATGGGCTAACACCTTCAAG

9 Sequence evolution © Broad Institute high degree of amino acid identity with other fungi(> 70 %) Acid trehalase (Tre2) Trehalose synthase 1 (TPS1) Trehalose phosphorylase (TP) Uridyltransferase (UGP1) Hexokinase 2 (Glk 2) low degree of amino acid identity (< 65 %) Neutral trehalase (Tre 1) Trehalose phosphorylase (TPS2) Trehalose synthase - regulatory sub-unit (TSL1) Hexokinase 1 (Glk1) Two groups of protein:

10 Sequence evolution M. griseus G. zeae N. crassa A. nigra A. fumigatus A. nidulans C. neoformens L. Bicolor A. muscaria Concensus M. griseus G. zeae N. crassa A. nigra A. fumigatus A. nidulans C. neoformens L. Bicolor A. muscaria Concensus M. griseus G. zeae N. crassa A. nigra A. fumigatus A. nidulans C. neoformens L. Bicolor A. muscaria Concensus M. griseus G. zeae N. crassa A. nigra A. fumigatus A. nidulans C. neoformens L. Bicolor A. muscaria Concensus Trehalose synthase 1 (TPS1) High level of aminoacid sequence conservation (> 70%) High level of aminoacid sequence conservation (> 70%)

11 Sequence evolution Hexokinase 1 (GLK1) Lower level of aminoacid sequence conservation (< 65%) N. crassa U. tritici M. griseus A. fumigatus L. bicolor P. involutus C. neoformens T. reesei consensus N. crassa U. tritci M. griseus A. fumigatus L. bicolor P. involutus C. neoformens T. reesei consensus N. crassa U. tritici M. griseus A. fumigatus L. bicolor P. involutus C. neoformens T. reesei consensus N. crassa U. tritici M. griseus A. fumigatus L. bicolor P. involutus C. neoformens T. reesei consensus

12 Sequence evolution 82 % 72 % 62 % 63 % 65 % 66 % 74 % Trehalose synthase 1 (TPS1) High degree of identity (>70 %) Acid trehalase (Tre2) Trehalose synthase 1 (TPS1) Trehalose phosphorylase (TP) Uridyltransferase (UGP1) Hexokinase 2 (Glk 2) Lower degree of identity (< 65%) Hexokinase 1 61 % 58 % 53 % 42 % 41 % 36 % 38 % Neutral trehalase (Tre 1) Trehalose phosphorylase (TPS2) Trehalose synthase - regulatory sub-unit (TSL1) Hexokinase 1 (Glk1) Ascomycetes Basidiomycetes

13 Carbohydrates metabolism: No main sugar biosynthesis pathway missing Trehalose metabolic specifities trehalose phosphorylasemetabolic specifities -> two ways of synthesis (trehalose phosphorylase) large intronspolyT repeatspresence of large introns with polyT repeats variable degree of conservation of aminoacid sequencevariable degree of conservation of aminoacid sequence CH 2 OHCH 2 OH* Summary © INRA

14 The bi-phospho-fructo aldolase, a duplicated gene ? scaffold 25 scaffold 12 nucleotidique sequence: 77 % of identity amino acid sequence: 90 % of identity Exactly same exon/intron structure and sizes No identity between UTR sequences and surounding sequences EST for one sequence: scaffold 25


Download ppt "Trehalose and carbohydrate metabolism of L. bicolor A. Deveau P. Frey-Klett, J.Garbaye, F. Martin et al. UMR INRA-UHP 1136 Interactions arbres micro-organismes."

Similar presentations


Ads by Google