1. National Centre for Biotechnology Education www.ncbe.reading.ac.uk The PCR and Plant evolution Copyright © Dean Madden, 2012

2. Stroma Outer membrane Inner membrane Starch granule Granum Stroma lamellae Lipid globule DNA within the chloroplast

3. Copyright © Dean Madden, 2012 Passed on in ovules No recombination Highly conserved (only insertions, deletions, and substitutions) 120–150 kb Encodes ~80 proteins Essential for photosynthesis Chloroplast DNA

4. Copyright © Dean Madden, 2012 RuBisCo

5. Copyright © Dean Madden, 2012 Angiosperm Phylogeny Group

6. Copyright © Dean Madden, 2012

10. RuBisCo — DNA sequence data AGP DNA encoding tRNA — Stable, in all plants Non-coding regions — High mutation rate NCBE/SAPS kit

11. Copyright © Dean Madden, 2012 tRNAtRNANON-CODING 300–500 bp Variation in the size of this region

12. Copyright © Dean Madden, 2012 Active site here strips primers from the DNA DNA is made at this active site

13. Copyright © Dean Madden, 2012 Taq polymerase Non-target DNA Target DNA Primers 50–65 °C Primers anneal to complementary sequences of bases in the single- stranded target DNA 72 °C Taq DNA polymerase Makes double-stranded DNA, using the single strands as templates 94–98 °C The double-stranded DNA is split into two strands

14. Copyright © Dean Madden, 2012 Taq polymerase Non-target DNA Target DNA Primers Start First cycle Second cycleThird cycleFourth cycle

15. Copyright © Dean Madden, 2012 Mass A microgram is one millionth of a gram 1 000 micrograms (µg) = 1 milligram (mg) 1 000 milligrams = 1 gram (g) Volume A microlitre is one millionth of a litre 1 000 microlitres (µL) = 1 millilitre (mL) 1 000 millilitres = 1 litre (L)

16. Copyright © Dean Madden, 2012 Soft rubber tubing Yellow graduated tip HOLD HERE Do not touch the point! 10 µL 20 µL 50 µL 100 µL Measure to the top of each band

17. Copyright © Dean Madden, 2012 Microsyringe Graduated tip HOLD HERE Do not touch the point! 10 µL 2 µL

18. Copyright © Dean Madden, 2012 Fixed volume micropipette Use yellow tips to dispense 20 µL volumes

19. Copyright © Dean Madden, 2012 Summary of the procedure

20. Copyright © Dean Madden, 2012 Place the leaf tissue on the card Ensure that it fits within the box

21. Copyright © Dean Madden, 2012 Close the cover and squash the leaf

22. Copyright © Dean Madden, 2012 Write the plant’s name in pencil on the cover Allow the card to dry for one hour

23. Copyright © Dean Madden, 2012 Cut discs using a punch

24. Copyright © Dean Madden, 2012 Push the disc from the punch using some plastic ‘wire’

25. Copyright © Dean Madden, 2012 100 µL Wash the disc twice in purification reagent Add 100 µL of purification reagent Flick to mix Remove the liquid REPEAT

26. Copyright © Dean Madden, 2012 100 µL Wash the disc twice in TE-1 buffer Add 100 µL of TE- 1 buffer Flick to mix Remove the liquid REPEAT

27. Copyright © Dean Madden, 2012 Primer 1 10 µL Primer 2 10 µL Water 4 or 6 µL PCR ‘bead’, containing: – Taq polymerase – buffer – dNTPs – magnesium chloride Primer 1: 5’–CGAAATCGGTAGACGCTACG–3’ Primer 2: 5’–GGGGATAGAGGGACTTGAAC–3’

28. Copyright © Dean Madden, 2012 Use forceps to add a disc to the plant DNA Label the tube

29. Copyright © Dean Madden, 2012 30 seconds Repeat this three-step cycle 30 times

30. Copyright © Dean Madden, 2012

31. Frosted panel on this side Molten agarose 55–60 °C

32. Copyright © Dean Madden, 2012 Cut two electrodes Carbon fibre tissue 42 mm 22 mm

33. Copyright © Dean Madden, 2012 Pour 2–3 mm depth of buffer over the gel before you ease the comb out

34. Copyright © Dean Madden, 2012 Mix loading dye into each DNA sample 2 µL Bromophenol blue loading dye Amplified DNA sample

35. Copyright © Dean Madden, 2012 Label the end of the tank to show the contents of each well Black card under the tank reveals the wells for loading Load the DNA through the buffer, taking care not to puncture the wells as you do so

36. Copyright © Dean Madden, 2012 Electrodes

37. Copyright © Dean Madden, 2012 Direction of DNA movement Place a comb over the tank to reduce evaporation

38. Copyright © Dean Madden, 2012 Leave the stain on for 4 minutes only Azure A stain

39. Copyright © Dean Madden, 2012 DNA Positively-charged Azure A binds to the negatively-charged phosphate groups of the DNA

40. Copyright © Dean Madden, 2012 Area with DNA bands WellsLoading dye

41. Copyright © Dean Madden, 2012 DNA ‘ruler’ or ‘ladder’ Sizes are in kb