1. Specificity of argonaute protein association with miRNA Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert

2. Importance of small RNA Gene regulation Growth and development Therapeutics Agriculture

3. miRNA Functions Dicer RISC proteins Target RNA degradation Translation arrest miRNA miRNA precursor (Zamore, Bartel, Sharp, Carrington labs)

4. Background Small RNA silencing is a mode of gene regulation. Argonaute proteins are the catalytic components of RISC. miRNAs guide AGOs to their targets. The nucleotide at the 5’ end is one source of miRNA specificity.

5. 5’ nucleotide specificity of AGO’s Kim, N. (2008) Cell Montgomery, et. al. (2008) Cell; Mi et. Al. (2008) Cell; Takeda, et. Al. (2008) Plant Cell Physiology

6. What We Know 5’ nucleotide specificity rule has exceptions. There are miRNA’s that associate with AGO1 and lack 5’U. AGO7 has no known 5’end nucleotide specificity. – Instead it only binds miR390. GOAL: Understand the rules of miRNA association with AGO’s.

7. miRNA Sequence miRNA’s that deviate from AGO1, 5’U rule contain U at eleventh position. Hypothesis: A uracil at position 11 is important for association with AGO1. miR390: AAGCUCAGGAGGGAUAGCGCC Binds AGO7 miR390-11U: AAGCUCAGGA U GGAUAGCGCC Binds AGO1 ??? miR172: AGAAUCUUGAUGAUGCUGCAU Binds AGO1 miR172-11G: AGAAUCUUGA G GAUGCUGCAU Binds AGO1 ???

8. How Construct mutant miRNAs. Infiltrate Nicotania benthamiana with constructs containing miRNAs, tagged proteins, and appropriate controls. Co-immunoprecipitation Small RNA gels HA-AGO Tissue Immunoprecipitate using HA antibody IP Fraction Small RNA gels Lyse Cells Input Fraction Small RNA gels

9. Position 11U Results miR172-11G associates with AGO1 11U is not a specificity determinant. Vector in HA HA-AGO1 in HA HA-AGO7 in HA Vector miR172 miR172-11G Vector miR390 miR390-11U Vector in HA HA-AGO1 in HA HA-AGO7 in HA miR390-11U associates with AGO7 and not AGO1 HA-AGO Tissue Immunoprecipitate using HA antibody IP Fraction Small RNA gels Lyse Cells Input Fraction Small RNA gels

10. Determine how non-5’U miRNAs are specified Too much background miR390 and miR172 Make new system using a miRNA that is distinguishable from endogenous miRNA but is still processed efficiently.

11. Alteration of miR390 Eliminate competition with other AGOs. Purine and pyrimidine conservation. Changed position 19 from a G to C – Choose miRNA over miRNA* Changed position 1 from an A to a G – 5’ end of miR390 doesn’t play a role in association. miR390: AAGCUCAGGAGGGAUAGCGCC miR390-5’G: G AGCUCAGGAGGGAUAGCGCC miR390: AAGCUCAGGAGGGAUAGCGCC miR390-19C: AAGCUCAGGAGGGAUAGC C CC

12. Alteration of miR390 Prediction: Both miR390-5’G and miR390-19C should bind AGO7 and accumulate as well as endogenous miR390.

13. miR390 Alteration Results miR390-5’G creates a 19 nucleotide small RNA miR390-19C accumulates more

14. miR390-5’G associates with AGO7 even though it is a 19 nucleotide small RNA. miR390 Alteration Results

15. Future Plans Create miR390 with single point mutations at every position. Test nonconserved miRNAs.

16. Acknowledgement Howard Hughes Medical Institute Dr. Jim Carrington Dr. Sunny Gilbert The Carrington Lab