1. WESTHER: A FISHY PROBLEM 1 School of Biological Sciences, The University of Liverpool, Crown Street, Liverpool L69 7BZ; 2 School of Biological Sciences, The University of Aberdeen, Tillydrone Avenue, Aberdeen AB24 2TZ; 3 FRS Marine Laboratory, PO Box 101, 375 Victoria Road, Aberdeen AB11 9DB; 4 Zoology, Ecology and Plant Science, National University of Ireland, Lee Maltings, Prospect Row, Cork, Ireland. INTRODUCTION Atlantic herring, Clupea harengus L., form the basis of a number of economically important European (EU) fisheries. The successful management of this resource to the west of the British Isles is dependent on an understanding of their stock structure because herring are highly migratory and it is not unusual for them to be caught outside their traditional management units. WESTHER is an EU funded multidisciplinary project that combines traditional fisheries techniques with modern population genetics. Our goal is to describe the structure of herring stocks from the Irish Sea to the north coast of Scotland (Figure 1). Through the genomic analysis of herring and their parasites we aim to differentiate between spawning aggregations, thereby creating reference points to help describe juvenile and mixed adult aggregations. Preliminary comparisons have been made with outlier samples from the Western Baltic and Northern Norway. Through an accurate description of the stock structure we hope to contribute to the management and sustainability of the fisheries and to the conservation of their biodiversity. HERRING GENOME ANALYSIS ANISAKIS spp. GENOME ANALYSIS Figure 1. Sampling Locations THIS PROJECT IS FUNDED BY THE EUROPEAN UNION UNDER THE 5 TH FRAMEWORK, CONTRACT NO. QLRT-2001-01056 http://www.clupea.net/westher Figure 2. C. harengus infected with L3 Anisakis spp. Preliminary analysis of Anisakis spp. From two geographically distinct areas (Western Baltic and Irish Sea) has found a total of eight polymorphic sites over a 250 base sequence of the CO1 region. Three haplotypes were identified from Irish Sea parasites and six haplotypes from the Western Baltic samples. No common haplotypes were found between the two areas (Table 3.). RESULTS FUTURE WORK To-date only a few parasites, from different locations, have been investigated, therefore these results are only preliminary. An increase in the number of samples analysed from the whole study area, and in consecutive years, will show if the observed haplotype variations are representative of discrete groupings of Anisakis spp. and therefore discrete host ( C. harengus ) populations, or a natural inherent variability in Anisakis’s CO1 gene over the whole study area. We are characterising genetic variation of C. harengus from each of the spawning areas, juvenile aggregations and fishery grounds designated in Figure 1. These data will be used to determine the extent of genetic separation among putative stock and also link individuals from nurseries and adults taken by in the targeted fisheries to their spawning stocks. All sampling is being repeated over two years targeting largely different cohorts, to assess the temporal stability of allele frequencies. A common parasitic nematode of herring are Anisakis spp. larvae. These are a group of morphologically similar sibling species. Larval Anisakis are excised from their herring hosts (Figure 2). Approximately 1000 bases of the mtDNA CO1 Region has been sequenced from individual parasites from different herring samples. Polymorphic sites distinguishing different haplotypes have been identified. Table 3. Nucleotide polymorphisms identifying different CO1 haplotypes S. Kay 1 *, M.A. Cross 1†, N. Campbell 2†, J.C. Chubb 1†, C. Collins 3†, J. Coughlan 4 *, T. Cross 4 *, C.O. Cunningham 3†, K. Mackenzie 2†, D. O’Leary 4 *, P.C Watts 1 * †, S. Wylde 4 * & E. Hatfield 3. * = HERRING GENOME ANALYSIS † = PARASITE GENOME ANALYSIS Herring DNA is extracted from fin clips or liver samples. Genotypes are characterised across 12-14 microsatellite loci (Table 1). Structure of spawning adults will be assessed using Bayesian population genetic statistics, e.g. STRUCTURE (Pritchard et al. 2000) & PARTITION (Dawson & Delkhir 2001), as well as through general multivariate statistical analysis. PRELIMINARYRESULTS PRELIMINARY RESULTS Table 1. Summary characteristics of the 14 microsatellite loci used to genotype C. harengus in WESTHER Table 2. Pairwise F ST among four samples of C. harengus Preliminary analyses of spawning adult samples indicate low levels of genetic variation among stocks from the western British Isles. There are significant genetic differences between some spawning aggregations from the western British Isles and the Baltic (Table 2). Baltic 03Baltic 04 C. WrathClyde Baltic 04 -0.02313 Cape Wrath 0.02443*-0.00014 Clyde 0.00668-0.02287-0.0091 Donegal 0.0287*0.01429*0.00562-0.00381 CelticSea 0.00415-0.02611-0.04816-0.08734 LocusMotifPrimer sequence (5'-3') Size rangeGeneBank Cpa101 ATCT 13 F: CATTGCCACCTACTGACCTGR: CACCCTGAAGATGATGAGGA182-324 Cpa106 ATCT 10 N 4 ATCT 10 F: CCATCCTCATCAAGAAAGCAR: GGTACTTTGACCTCTCCTCTCC169-233 Cpa107 ATCT 19 F: ATGATTTTTCGCCTTTTGCTR: CCCAGAAACAAGAGCTAGGC165-281AF406943 Cpa111 TAGA 8 F: TGTCCAGTAAAACATGCCTGAR: GCTCCGTTCTCTTTCTTGCT232-308AF406947 Cpa112 TAGA 7 F: GAGAGGGAGTTAAAATTGACAGCR: GGCACAAGATGAGAGTGCAG256-468 Cpa113 ATCT 17 F: TGTCCATCTGTCCATTCAGCR: ACCACACAGCACATTTACAGG130-194 Cpa114 ATCT 10 F: GCGTTTGTCCATACCACATTR: CAGCTCTGAAAACCCAGACA201-265 Cpa4 (GACA) 10 F: CTTATCTGTCTGACTGCCTATTTGR: GTTTCTTCTCTGCTCCACCCAGAA97-180AF309800 Cpa6 (GATA) 14 F: GTGTGAGTTTGCTCCAAAR: GTTTGTACCAATGAATGATTACAA141-251AF309801 cha1020GACAF: CCTGGAGAGACAGATAGAAAAR: GAGTTTAGCAGACGCTTTA160-224AF289095 cha1202GACAF: TTTCCGTTACACTTTCACATCGR: GTGCCTCAGTTTTCACATACA92-148AF304363 cha1059GACAF: CATCTACCACCTCCGACTCCR: AATCTAAAGGAAGCCCACTC66-108AF289094 Cha1027GACAF: ATTCAACCCCCTCACAGAR: TGAGGCAGCAGACGATACAC110-202AF290885 Cha1017GATAF: GGTCTCATTATCTTCTCACTCTTTTGR: TCTCCCTATGTGTATTGTTTTACTGTG162-206AF289096 AF406937 AF406942 AF406948 AF406950 AF406949