Presentation is loading. Please wait.

Presentation is loading. Please wait.

Biological Databases [S2] E NRIQUE B LANCO NUMBER OF SLIDES: 5 EXPECTED TIME: 15 minutes.

Similar presentations


Presentation on theme: "Biological Databases [S2] E NRIQUE B LANCO NUMBER OF SLIDES: 5 EXPECTED TIME: 15 minutes."— Presentation transcript:

1 Biological Databases [S2] E NRIQUE B LANCO NUMBER OF SLIDES: 5 EXPECTED TIME: 15 minutes

2 Biological Databases [S2] - ENRIQUE BLANCO COMPUTER ANALYSIS >sequence TACGTACGTAGCTAGCTAGCTACGTAGCTAGCTA GCTACGTAGCTAATGTCGAAGTAACGTACGATCG TAGCTAGCTAGCTGATGCTATCGTAGCTAGCTGA TGCATGCGCTAAACACATCGCTTTGGCACGAGCT AGCTAGCTACTACAGCACGGGGGCACGTAGTGCA GCTAGCAGCCGCCGCATCGCCCCCCGATCGATCG TAGCCGACGATCTACTACGTAGCGACTGACTGAT CGATGAGGATCGTGAGCTAGCGTGCTAGCTAGCT AGCTAGCTAGCTAGCTAGCAGCTACGTACGTAGC TAGCTACGAGCAGCTAGCTAGCTACGAC += GENE 1 FEATURE 1 FEATURE 2 … FEATURE m GENE 2 FEATURE 1 FEATURE 2 … FEATURE m GENE n FEATURE 1 FEATURE 2 … FEATURE m …

3 Biological Databases [S2] - ENRIQUE BLANCO ONE DATA SET GENE 1 FEATURE 1 FEATURE 2 … FEATURE m GENE 2 FEATURE 1 FEATURE 2 … FEATURE m GENE n FEATURE 1 FEATURE 2 … FEATURE m … SORT REARRANGE FEATURE m+1 ADD/CONVERT/EXTRACT FILTER

4 Biological Databases [S2] - ENRIQUE BLANCO TWO DATA SETS GENE 1 FEATURE 1 FEATURE 2 GENE 2 FEATURE 1 FEATURE 2 GENE m FEATURE 1 FEATURE 2 … GENE 1 GENE 2 GENE n … FEATURE 1 FEATURE 3 FEATURE 1 FEATURE 3 FEATURE 1 FEATURE 3

5 Biological Databases [S2] - ENRIQUE BLANCO PIPELINES/WORKFLOWS >chromosome1 TACGTACGTAGCTAGCTAGCTACGTAGCTAGCTA GCTACGTAGCTAATGTCGAAGTAACGTACGATCG TAGCTAGCTAGCTGATGCTATCGTAGCTAGCTGA TGCATGCGCTAAACACATCGCTTTGGCACGAGCT AGCTAGCTACTACAGCACGGGGGCACGTAGTGCA GCTAGCAGCCGCCGCATCGCCCCCCGATCGATCG TAGCCGACGATCTACTACGTAGCGACTGACTGAT CGATGAGGATCGTGAGCTAGCGTGCTAGCTAGCT AGCTAGCTAGCTAGCTAGCAGCTACGTACGTAGC TAGCTACGAGCAGCTAGCTAGCTACGAC >chromosome22 TACGTACGTAGCTAGCTAGCTACGTAGCTAGCTA GCTACGTAGCTAATGTCGAAGTAACGTACGATCG TAGCTAGCTAGCTGATGCTATCGTAGCTAGCTGA TGCATGCGCTAAACACATCGCTTTGGCACGAGCT AGCTAGCTACTACAGCACGGGGGCACGTAGTGCA GCTAGCAGCCGCCGCATCGCCCCCCGATCGATCG TAGCCGACGATCTACTACGTAGCGACTGACTGAT CGATGAGGATCGTGAGCTAGCGTGCTAGCTAGCT AGCTAGCTAGCTAGCTAGCAGCTACGTACGTAGC TAGCTACGAGCAGCTAGCTAGCTACGAC … >sequence TACGTACGTAGCTAGCTAGCTACGTAGCTAGCTA GCTACGTAGCTAATGTCGAAGTAACGTACGATCG TAGCTAGCTAGCTGATGCTATCGTAGCTAGCTGA TGCATGCGCTAAACACATCGCTTTGGCACGAGCT AGCTAGCTACTACAGCACGGGGGCACGTAGTGCA GCTAGCAGCCGCCGCATCGCCCCCCGATCGATCG TAGCCGACGATCTACTACGTAGCGACTGACTGAT CGATGAGGATCGTGAGCTAGCGTGCTAGCTAGCT AGCTAGCTAGCTAGCTAGCAGCTACGTACGTAGC TAGCTACGAGCAGCTAGCTAGCTACGAC +

6 Biological Databases [S2] - ENRIQUE BLANCO GALAXY https://main.g2.bx.psu.edu/

7 Biological Databases [S2] E NRIQUE B LANCO NUMBER OF SLIDES: 5 EXPECTED TIME: 15 minutes


Download ppt "Biological Databases [S2] E NRIQUE B LANCO NUMBER OF SLIDES: 5 EXPECTED TIME: 15 minutes."

Similar presentations


Ads by Google