1. Tnk1/Kos1 knockout mice develop spontaneous tumors Sarasija Hoare, Kishalay Hoare, Mary K. Reinhard, Young J. Lee, S. Paul Oh, and W. Stratford May University of Florida Cancer Research 68:8723-8732 November 2008

2. Tnk1/Kos1 Tnk1 is a non-receptor tyrosine kinase Negatively regulates Ras activation through phosphorylation of Grb2 Do you predict this to be an oncogene or a TSG? Trans Am Clin Climatol Assoc. 121: 281

3. Tnk1/Kos1 Alternative splicing If the exon-intron junction at the end of exon 8 isn’t used, a polyA signal is encountered Encodes Kos1 (or Tnk1b) Fig. S2

4. Adapted from Molecular Cell Biology by Lodish et al. (ES cells) Making Tnk1/Kos1 -/- mice

5. Image adapted from www.nobelprize.org Matches parts of Tnk1/Kos1 neo r allows the cells to resist the drugs in the neomycin family (like G418) HSV-tk is the thymidine kinase gene from herpes simplex virus Making Tnk1/Kos1 -/- mice

6. Image adapted from www. nobelprize.org neo r added HSV-tk lost Making Tnk1/Kos1 -/- mice

7. Fig. 1A Making Tnk1/Kos1 -/- mice  Sites for restriction enzymes

8. Making Tnk1/Kos1 -/- mice Fig. 1A

9. Image adapted from Molecular Cell Biology by Lodish et al. (heterozygous)

10. Some mosaics will be Tnk1/Kos1 +/- in their germ cells. Mate together for Tnk1/Kos1 - /- Image adapted from www.nobelprize.org Recombinant ‘knockout’ cells injected into blastocysts of C57BL/6 mice Making Tnk1/Kos1 -/- mice

11. Determine mouse genotype by Southern blotting Collect genomic DNA from tail Digest with BamHI Separate by gel electrophoresis Blot with “3’ probe” Wt allele is 7.8kb Deletion allele is 4.2kb Fig. 1AB

12. Making Tnk1/Kos1 -/- mice Fig. 1CD Western blots Liver Cell LysatesMouse Embryo Fibroblasts (MEFs) Only Kos1 (45kD) seen on western blots. No Tnk1 (72kD)

13. Phenotype of Tnk1/Kos1 -/- mice 27% (14/52) of the heterozygous mice developed tumors. 72% epithelial

14. Phenotype of Tnk1/Kos1 -/- mice 43% (12/28) of the homozygous mice developed tumors. 75% lymphoid

15. Phenotype of Tnk1/Kos1 -/- mice One tumor histology example Stained with H&E (hematoxylin and eosin) Hepatocellular carcinoma at 40x or 400x Fig. 2NO

16. Phenotype of Tnk1/Kos1 -/- mice Trans Am Clin Climatol Assoc. 121: 281

17. Kos1 Inhibition of Ras Are these tumors due to excessive activation of Ras? How can we determine if Ras is activated or not in vivo? We know that Ras-GTP binds Raf but Ras-GDP does not bind Raf Measure how much Ras can bind Raf Isolate the Ras Binding Domain (RBD) of Raf Fuse to another protein (GST, glutathione-S-transferase), for easy manipulation

18. Raf-RBD Created a GST (Glutathione-S-Transferase) fusion protein Making a fusion gene: GST stop codon removed first codon of Raf-RBD cDNA is just after the last codon of GST Recombinant Plasmid Kos1 Inhibition of Ras

19. Immobilize Raf-RBD by creating a GST fusion protein Glutathione-S-Transferase binds reduced glutathione (GSH) Express protein in E. coli Since GST binds to glutathione, the fusion protein will bind to insoluble beads with glutathione on the surface GST Raf-RBD N C Kos1 Inhibition of Ras

20. Transform recombinant plasmid into E. coli host. P tac promoter is derived from the lac promoter can be strongly induced with IPTG (structurally similar to lactose) Lyse E. coli. Purify GST-Raf-RBD on column of reduced glutathione (GSH)-beads. Wash away other E. coli proteins. GST Raf-RBD Kos1 Inhibition of Ras

21. Add mouse liver cell lysate (includes Ras-GDP and Ras-GTP) Only Ras-GTP sticks. Ras-GDP (and all other proteins) are washed away. Wash. Elute proteins by denaturation. Western blot for Ras. GST Raf-RBD Kos1 Inhibition of Ras

22. Mouse liver cell lysate Pulled down with GST-Raf-RBD Ras western blot Quantified Fig. 3A Tnk1/Kos1 Status: Kos1 Inhibition of Ras

23. Does lack of Tnk1/Kos1 affect activation of Ras by EGF? MEFs grown on a plate. Serum-starved 24 hours Treated with EGF for 5 min. Pull-down with GST-Raf-RBD Western blot for Ras Fig. 3B Kos1 Inhibition of Ras

24. Does lack of Tnk1/Kos1 affect activation of Ras by EGF? Can also answer this question by looking downstream, at Erk phosphorylation. Phospho-specific antibody Normal tissue, tumor or MEFs Fig. S4 Kos1 Inhibition of Ras

25. …AUGGAUUAUAAAGACCAUGAUGAUUAUAAAGACCAUGAUGAUUAUAAAGACCAUGAUAUGCUU… N-Met-Asp-Tyr-Lys-Asp-His-Asp-Asp-Tyr-Lys-Asp-His-Asp-Asp-Tyr-Lys-Asp-His-Asp-Met-Leu-… HA Epitopes Start of Kos1 3xHA N- -C Kos1 3xHA Does lack of Tnk1/Kos1 affect activation of Ras by EGF? Unmodified NIH3T3 cells Overexpress Kos1 Kos1 on a plasmid with strong promoter HA epitope tag also a CN = catalytically null allele Lys148  Ala blocks ATP binding Kos1 Inhibition of Ras

26. Unmodified NIH3T3 cells. Overexpress Kos1 (or controls). Series of western blots Fig. S3 HA western blot Kos1 Inhibition of Ras

27. Unmodified NIH3T3 cells. Overexpress Kos1 (or controls). Series of western blots Fig. S3 HA western blot GST-Raf-RBD pull-down Ras western blot Phospho-Erk western blot Erk western blot Kos1 Inhibition of Ras

28. Does Kos1 inhibit Ras? Which figure makes the strongest argument? Why so much redundancy? Fig. S4 Fig. 3AB Fig. S3

29. Kos1 Phosphorylates Grb2 Kos1 is a kinase; does it inhibit Ras activity by phosphorylation? in vitro kinase assay Recombinant Grb2 protein Mammalian cells transfected with plasmid expressing GFP-Kos1 or GFP-Kos1(CN) GFP-Kos1 was purified by immunoprecipitation (IP)

30. A Immunoprecipitation (IP) Lyse cells. Add anti-GFP antibody Add Protein A attached to an insoluble bead Wash away unattached molecules Kos1 Phosphorylates Grb2

31. in vitro kinase assay Kinase: GFP-Kos1 Substrate: Grb2 protein Substrate: 32 P-  -ATP Separate proteins by electrophoresis Expose gel to film. Radioactivity will expose the film Kos1 Phosphorylates Grb2

32. in vitro kinase assay Kinase: GFP-Kos1 Substrate: Grb2 protein Substrate: 32 P-  -ATP Separate proteins by electrophoresis Expose gel to film. Radioactivity will expose the film Kos1 Phosphorylates Grb2 Fig. S6

33. and a few controls Kos1 Phosphorylates Grb2 Fig. S6

34. Kos1 also phosporylates itself! Kos1 Phosphorylates Grb2 Fig. S6

35. Another way to detect the phosphorylated products. Nonradioactive ATP After allowing the kinase to work, western blot with an anti-phosphotyrosine antibody Kos1 Phosphorylates Grb2 Fig. S6

36. Kos1 Phosphorylates Grb2 Fig. 4B That was in vitro. Does Kos1 phosphorylate Grb2 in vivo? Cells transfected with Flag-tagged Kos1 (wt or CN) IP Sos1 Grb2 also co-immunoprecipitates (coIPs) Series of western blots Conclusion?

37. Kos1 Phosphorylates Grb2 Fig. 4C That was in cell culture. Does Kos1 phosphorylate Grb2 in a living animal? Livers from knockout mice IP Grb2. Detect phosphorylation with anti-phosphotyrosine antibody western blot

38. Kos1 Phosphorylates Grb2 Fig. 4D Hypothesis: Phosphorylation of Grb2 blocks it’s association with Sos1 coIP experiment. Liver cell lysate. IP with Sos1 antibody. Western blot for Grb2. Is the hypothesis supported or refuted?

39. Epigenetic Silencing of Tnk1/Kos1 27% (14/52) of the heterozygous mice developed tumors. If Kos1 is a tumor suppressor protein, why do these tumors develop? Hypothesis #1: Haploinsufficiency Two functional Tnk1/Kos1 genes are needed to suppress tumors Hypothesis #2: Somatic mutation The wildtype allele has been mutated Hypothesis #3: Epigenetic silencing The wildtype allele has been silenced

40. Epigenetic Silencing of Tnk1/Kos1 from non-tumor tissue Fig. 5A Testing Hypothesis #1: Haploinsufficiency GTP-Ras assay on mice What data would support this hypothesis? GTP-Ras level similar to non-tumor tissue What data would refute this hypothesis? GTP-Ras level similar to Tnk1 -/-

41. Epigenetic Silencing of Tnk1/Kos1 Fig. 5C Testing Hypothesis #1: Haploinsufficiency Also measured Kos1 levels by western blotting

42. Epigenetic Silencing of Tnk1/Kos1 Testing Hypothesis #2: Somatic mutation Not directly tested. How would you test it?

43. Epigenetic Silencing of Tnk1/Kos1 Testing Hypothesis #3: Epigenetic silencing Methylation of CpG dinucleotides near promoters leads to silencing

44. Epigenetic Silencing of Tnk1/Kos1 Testing Hypothesis #3: Epigenetic silencing Purify genomic DNA from tumors Modify DNA with Sodium Bisulfite Unmethylated cytosines become Uracils Methylated cytosines are protected

45. Epigenetic Silencing of Tnk1/Kos1 Testing Hypothesis #3: Epigenetic silencing Designed PCR primers for 136 bp of Tnk1/Kos1 promoter Primer: 5’ GAAAACGAAAAAAACAACTACGAA 3’ Target Site: GAAAACGAAAAAAACAACTACGAA CTTTTGCTTTTTTTGTTGATGCTT if not methylated, primers won’t bind well! GAAAAUGAAAAAAACAACTAUGAA CTTTTGUTTTTTTTGTTGATGUTT -CH 3

46. Epigenetic Silencing of Tnk1/Kos1 Testing Hypothesis #3: Epigenetic silencing Methylation-Specific PCR Fig. 5B AdenocarcinomaNormal Liver Tissue, Tnk1 +/+ Hepatocellular carcinomaHepatomaLymphoma

47. Major Conclusions Loss of Tnk1/Kos1 increases tumor frequency (Table 1) Kos1 inhibits Ras activity (Fig. 3) Kos1 phosphorylates Grb2, inhibiting its association with Sos1 (Fig. 4) Tnk1/Kos1 promoter can be methylated (Fig. 5) Major New Techniques for us Knockout mouse GST fusion proteins Epitope tagging IP/coIP in vitro kinase assay Phosphorylation-specific western blot Methylation-specific PCR