1. Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics August 15, 2010

2. Collagen VI myopathies  Bethlem Myopathy  Proximal muscle weakness and atrophy  Dynamic contractures in distal joints (fingers, wrists, elbows, and ankles)  Onset in first or second decade  Slowly progressive in adult years  2/3 of patients >50 years-old require assistance for ambulation  Ullrich Congenital Muscular Dystrophy  Severe weakness/hypotonia in early infancy  Proximal joint contractures  Distal joint hyperlaxity  Collagen VI myopathies likely represent spectrum of phenotypes defined by type and distribution of contractures

3. Three genes of Collagen VI C  1(VI)  2(VI)  3(VI) N10N9N8N7N6N5N4N3N2 N1 C1 C2TH C1C2THC4C3C5 C C von Willebrand factor A domain Alternatively spliced vWF A Triple-helix Lysine/proline repeats Fibronectin type III motif Kunitz protease inhibitor motif

4. COL6A1- 4246 base pairs  gctctcactctggctgggagcagaaggcagcctcggtctctgggcggcggcggcggccca ctctgccctggccgcgctgtgtggtgaccgcaggccccagacatgagggcggcccgtgct ctgctgcccctgctgctgcaggcctgctggacagccgcgcaggatgagccggagaccccg agggccgtggccttccaggactgccccgtggacctgttctttgtgctggacacctctgag agcgtggccctgaggctgaagccctacggggccctcgtggacaaagtcaagtccttcacc aagcgcttcatcgacaacctgagggacaggtactaccgctgtgaccgaaacctggtgtgg aacgcaggcgcgctgcactacagtgacgaggtggagatcatccaaggcctcacgcgcatg cctggcggccgcgacgcactcaaaagcagcgtggacgcggtcaagtactttgggaagggc acctacaccgactgcgctatcaagaaggggctggagcagctcctcgtggggggctcccac ctgaaggagaataagtacctgattgtggtgaccgacgggcaccccctggagggctacaag gaaccctgtggggggctggaggatgctgtgaacgaggccaagcacctgggcgtcaaagtc ttctcggtggccatcacacccgaccacctggagccgcgtctgagcatcatcgccacggac cacacgtaccggcgcaacttcacggcggctgactggggccagagccgcgacgcagaggag gccatcagccagaccatcgacaccatcgtggacatgatcaaaaataacgtggagcaagtg tgctgctccttcgaatgccagcctgcaagaggacctccggggctccggggcgaccccggc tttgagggagaacgaggcaagccggggctcccaggagagaagggagaagccggagatcct ggaagacccggggacctcggacctgttgggtaccagggaatgaagggagaaaaagggagc cgtggggagaagggctccaggggacccaagggctacaagggagagaagggcaagcgtggc atcgacggggtggacggcgtgaagggggagatggggtacccaggcctgccaggctgcaag ggctcgcccgggtttgacggcattcaaggaccccctggccccaagggagaccccggtgcc tttggactgaaaggagaaaagggcgagcctggagctgacggggaggcggggagaccaggg agctcgggaccatctggagacgagggccagccgggagagcctgggccccccggagagaaa ggagaggcgggcgacgaggggaacccaggacctgacggtgcccccggggagcggggtggc cctggagagagaggaccacgggggaccccaggcacgcggggaccaagaggagaccctggt gaagctggcccgcagggtgatcagggaagagaaggccccgttggtgtccctggagacccg ggcgaggctggccctatcggacctaaaggctaccgaggcgatgagggtcccccagggtcc gagggtgccagaggagccccaggacctgccggaccccctggagacccggggctgatgggt gaaaggggagaagacggccccgctggaaatggcaccgagggcttccccggcttccccggg tatccgggcaacaggggcgctcccgggataaacggcacgaagggctaccccggcctcaag ggggacgagggagaagccggggaccccggagacgataacaacgacattgcaccccgagga gtcaaaggagcaaaggggtaccggggtcccgagggcccccagggacccccaggacaccaa ggaccgcctgggccggacgaatgcgagattttggacatcatcatgaaaatgtgctcttgc tgtgaatgcaagtgcggccccatcgacctcctgttcgtgctggacagctcagagagcatt ggcctgcagaacttcgagattgccaaggacttcgtcgtcaaggtcatcgaccggctgagc cgggacgagctggtcaagttcgagccagggcagtcgtacgcgggtgtggtgcagtacagc cacagccagatgcaggagcacgtgagcctgcgcagccccagcatccggaacgtgcaggag ctcaaggaagccatcaagagcctgcagtggatggcgggcggcaccttcacgggggaggcc ctgcagtacacgcgggaccagctgctgccgcccagcccgaacaaccgcatcgccctggtc atcactgacgggcgctcagacactcagagggacaccacaccgctcaacgtgctctgcagc cccggcatccaggtggtctccgtgggcatcaaagacgtgtttgacttcatcccaggctca gaccagctcaatgtcatttcttgccaaggcctggcaccatcccagggccggcccggcctc tcgctggtcaaggagaactatgcagagctgctggaggatgccttcctgaagaatgtcacc gcccagatctgcatagacaagaagtgtccagattacacctgccccatcacgttctcctcc ccggctgacatcaccatcctgctggacggctccgccagcgtgggcagccacaactttgac accaccaagcgcttcgccaagcgcctggccgagcgcttcctcacagcgggcaggacggac cccgcccacgacgtgcgggtggcggtggtgcagtacagcggcacgggccagcagcgccca gagcgggcgtcgctgcagttcctgcagaactacacggccctggccagtgccgtcgatgcc atggactttatcaacgacgccaccgacgtcaacgatgccctgggctatgtgacccgcttc taccgcgaggcctcgtccggcgctgccaagaagaggctgctgctcttctcagatggcaac tcgcagggcgccacgcccgctgccatcgagaaggccgtgcaggaagcccagcgggcaggc atcgagatcttcgtggtggtcgtgggccgccaggtgaatgagccccacatccgcgtcctg gtcaccggcaagacggccgagtacgacgtggcctacggcgagagccacctgttccgtgtc cccagctaccaggccctgctccgcggtgtcttccaccagacagtctccaggaaggtggcg ctgggctagcccaccctgcacgccggcaccaaaccctgtcctcccacccctccccactca tcactaaacagagtaaaatgtgatgcgaattttcccgaccaacctgattcgctagatttt ttttaaggaaaagcttggaaagccaggacacaacgctgctgcctgctttgtgcagggtcc tccggggctcagccctgagttggcatcacctgcgcagggccctctggggctcagccctga gctagtgtcacctgcacagggccctctgaggctcagccctgagctggcgtcacctgtgca gggccctctggggctcagccctgagctggcctcacctgggttccccaccccgggctctcc tgccctgccctcctgcccgccctccctcctgcctgcgcagctccttccctaggcacctct gtgctgcatcccaccagcctgagcaagacgccctctcggggcctgtgccgcactagcctc cctctcctctgtccccatagctggtttttcccaccaatcctcacctaacagttactttac aattaaactcaaagcaagctcttctcctcagcttggggcagccattggcctctgtctcgt tttgggaaaccaaggtcaggaggccgttgcagacataaatctcggcgactcggccccgtc tcctgagggtcctgctggtgaccggcctggaccttggccctacagccctggaggccgctg ctgaccagcactgaccccgacctcagagagtactcgcaggggcgctggctgcactcaaga ccctcgagattaacggtgctaaccccgtctgctcctccctcccgcagagactggggcctg gactggacatgagagccccttggtgccacagagggctgtgtcttactagaaacaacgcaa acctctccttcctcagaatagtgatgtgttcgacgttttatcaaaggccccctttctatg ttcatgttagttttgctccttctgtgtttttttctgaaccatatccatgttgctgacttt tccaaataaaggttttcactcctctaaaaaaaaaaaaaaaaaaaaa

5. Where are we now in collagen VI myopathies?  Collagen VI disorders are increasingly recognized  Likely among the most common muscular dystrophies/myopathies  Clinical spectrum expanding  Progression/prognosis are not well defined  No specific treatments  Treatments in development based on correction of abnormal mitochondrial function  Outcome measures for potential clinical studies are not well defined  How do we measure success of a particular therapy?

6. Where are we in genetics of Collagen VI  Dominant and recessive inheritance has been described for both BM and UCMD  Most mutations identified are specific to a single person/family  Variant vs. mutation is often unclear  Consistent genotype/phenotype correlations lacking

7. Collagen VI at the University of Utah  CLIA certified genetic testing has been available at the Utah Genome Center since 2006  To date, testing has been completed almost 400 patients.  Since patient samples are sent without clinical data we do not know the clinical history of these patients  Natural history and genotype/phenotype project  Re-contacting all patients who have had genetic testing for collagen VI to collect detailed clinical data allowing correlation with the genotype data already obtained.

8. United Dystrophinopathy Project  Multi-centered natural history and genotype/phenotype study  Now >1000 participants from 7 participating centers  Children's Hospital of Philadelphia, Philadelphia, PA  University of Minnesota, Minneapolis, MN  Nationwide Children's Hospital, Columbus, OH  University of Iowa, Iowa City, Iowa  University of Utah, Salt Lake City, UT  Washington University, St. Louis, MO  University of California, Davis, Sacramento, California  Patients are seen on yearly basis  Confirmation of genetic diagnosis

9. 390 clinical samples genotyped 163 patients with variant detected 141 patients with no mutation detected 47 negative 39 positive 304 Full sequencing of COL6A1,2,3 86 Parent/sib carrier testing Of 163 with variant detected: 91 probably pathogenic, 72 unknown significance

10. Genes Muscle Patient COL6A

11. Collagen VI myopathy study at Utah  Catalog detailed clinical and genetic data in patients with Collagen VI myopathies  Clarify breadth of potential phenotypes  Detail natural history (progression over time)  Improve accuracy of genetic diagnosis and prognosis  Define genotype/phenotype relationships  Stimulate development of potential therapies  Provide a resource for investigators conducting clinical trials  Well defined cohorts  Appropriate outcome measures  Improved understanding of molecular pathogenesis  Facilitate collaboration among investigators, families, and others  Integration with CMDIR  Establishment of collaborations leaders in the field

12. Patient Recruitment  Primary recruitment from Utah Genome Center since Jan 2010  Over 400 patients with genetic testing since 2006 with 50 enrolled thus far  Goal is to re-contact patients for whom we have completed sequencing to collect clinical data  Primary contact is through referring physician  Anticipated expansion of enrollment to include any patient with collagen VI myopathy diagnosis  Summer 2010

13. Enrollment/Participation  All patients with collagen VI myopathy phenotypes (ie. Bethlem myopathy or Ullrich CMD) are eligible to enroll  A clinic visit is not required for participation  Participants will fill out a short questionnaire detailing symptoms and physical findings  We will request records from treating physicians including results of genetic testing (if done outside UGC) and other diagnostic tests  In some cases, we may request a sample from skin or muscle biopsy if they are already in existence

14. A couple areas of interest in our lab  Mutation negative collagen VI patients  46% patients with no identifiable mutation  Some of these with decreased collagen VI on muscle or skin biopsy  Potential explanations:  Deletion mutation not identifiable by sequencing from genomic DNA  Mutation in non-coding regulatory region  Allelic locus or secondary collagen VI defect  Non-collagen VI disorder  Defining pathogenicity (or non-pathogenicity) “variants”  163/304 samples with sequencing of all 3 COL6A genes identified variant  72 of these (44%) are of uncertain pathogenicity  High throughput genomics—transcriptome, exome sequencing

15. Acknowledgements  Utah Genome Center, Robert Weiss, Director  Weiss lab: Diane Dunn, Brett Duval  Kathryn Swoboda  Swoboda group: Lahdan Heidarian  Collaborators  Kevin Flanigan-Nationwide Children’s  Carsten Bönnemann-CHOP  Funding:  Muscular Dystrophy Association  NIH-Loan Repayment Program  Primary Children’ Foundation, CHRC Thank you to CureCMD for the opportunity to participate in this conference.