1. A generalist tymovirus of the tallgrass prairie Michael Palmer 1 Andrew Doust 1 Rick Nelson 2 Min Byoung 2 Vaskar Thapa 1 Marilyn Roossinck 2 Ulrich Melcher 1 1 Oklahoma State University 2 Samuel Roberts Noble Foundation

2. Plant Virus Biodiversity and Ecology PVBE Methods Preliminary Results Confusions

3. Disclaimer: I am not a virologist

4. Plant Virus Biodiversity and Ecology (PVBE) An attempt to document the presence of viruses in plants of the Nature Conservancy’s Tallgrass Prairie Preserve, and to generate testable hypotheses

5. PVBE People Virologists, ecologists, geneticists, bioinformaticians, computer scientists

6. Known viruses species are mostly from cultivated plants

7. Plants of the Tallgrass Prairie Preserve

8. Forest cover Acidity, sand Sandstone Limestone or bottomland Tallgrass Prairie mesic forest savannas Shortgrass prairie / limestone outcrops crosstimbers Sandstone outcrops

9. PVBE schema Sample plants Extract nucleic acids and sequence Mine data and interpret Propose and test ecological hypotheses Current status

10. Plants are sampled without regard for symptoms

11. PVBE schema Broad survey Extract nucleic acids and sequence Mine data and interpret Propose and test ecological hypotheses “target plant species” Ambrosia psilostachya Asclepias viridis Panicum virgatum Sorghastrum nutans Vernonia baldwinii Ruellia humilis

12. Ambrosia psilostachya, western ragweed Asclepias viridis, antelope-horn milkweed Panicum virgatum, switchgrass Sorghastrum nutans, Indiangrass Ruellia humilis, wild/prairie petuniaVernonia baldwini, western ironweed Selected target species

13. 10m Vegetation monitoring plots

14. PVBE schema Broad survey Extract nucleic acids and sequence Mine data and interpret Propose and test ecological hypotheses “target plant species” Ambrosia psilostachya Asclepias viridis Panicum virgatum Sorghastrum nutans Vernonia baldwinii Ruellia humilis dsRNA isolation with 454 pyrosequencing Virus-like particle isolation

15. PVBE schema Broad survey Extract nucleic acids and sequence Mine data and interpret Propose and test ecological hypotheses “target plant species” Ambrosia psilostachya Asclepias viridis Panicum virgatum Sorghastrum nutans Vernonia baldwinii Ruellia humilis dsRNA isolation with 454 pyrosequencing Virus-like particle isolation Intense study of Asclepias viridis by RT-PCR

16. Young leaves (5 g) Grind in liquid nitrogen Transfer into 50 ml tube containing 10 ml extraction buffer and 10 ml Ph:Ch Mix vigorously to form emulsion Centrifuge Transfer top phase into new tube Repeat Ph:Ch extraction Final aqueous phase Total NA (for bar coding and making hybridization target) Add absolute proof ethanol (16,5% of aqueous volume) Pass through enocolumn containing CF11powder cellulose binding dsRNA (if ethanol concentration is 16,5%) Wash in 6 time with application buffer Add elution buffer Transfer eluate to a 15 ml tube Precipitate with NaOAc and EtOH overnight at -20 ْ C Centrifuge to pellet dsRNA Decant and resuspend in 0,1 mM EDTA / 0.3 M NaOAC Transfer to a microcentrifuge tube and fill with cold ethanol to reprecipitate Resuspend in 50 mkl 0.1 mM EDTA Check the dsRNA by electrophoresis on a 1.5% agarose gel in 0.5X TBE II 1234 Lad 1 kb 506,5 1 1,6 2 12,2 396 Extraction buffer: 0.1 M NaCl 50 mV Tris, pH 8 1 mV EDNA, pH 8 1% SDS Application buffer: 0.1 M NaCl 50 mM Tris, pH8 0.5 mV EDTA, pH8 16.5% Ethanol Elution buffer: 0.1 M NaCl 50 mV EDTA, pH 8 Buffers Laboratory method for double-stranded RNA purification 344 298 bp Vernonia baldwinii (line 1) and Flavoparmelia sp. (line 4) have no dsRNA. Ambrosia psilostachya (line 2) and Parmelia sp1. (line 3) show bands for dsRNA Protocol for ds RNA isolation adopted from M. Roossinck, 2005

17. 454 sequencing Sophisticated, high-throughput system – but easier said than done

18. Preliminary (2006) Results 592 specimens analyzed 296 plant species in 307 genera and 91 families 308 specimens are positive for dsRNA (i.e. probable viruses) 2007-2008 Results not yet tabulated on project database high rate of novelties detected by main methods many ‘fungal’ viruses

20. BLAST results: One virus is predominantly found in Asclepias viridis that appears that is distinct from, but has high similarity to, Kennedya yellow mosaic tymovirus

21. From ICTVdB Tymovirus http://virology.wisc.edu Icosahedral virion ssRNA Genome 6000-7000nt Infects dicots Symptoms none to severe; appear in leaves Transmitted by beetles

22. Asclepias viridisOther species Virus-like particle dsRNA (454)

23. Tymovirus in Asclepias viridis

25. 10m buffer 2525 2626 2727 2828 2929 3131 3030 32323 3434 3535 -5 buffer 1 2 3 4 5 6 7 8 9 1010 1 1212 1414 1313 1515 1616 1717 1818 1919 2020 2121 2 2323 2424 3636 3737 3838 4040 3939 4141 4242 4343 4545 4646 4 4747 4848 4949 5050 5151 Plot 343 (Stadia) -15 0 5 10 15 20 25 -35-25-15-5515 Distance (m) Red- Tymovirus infection Black – no Tymovirus Plot 307 (Sand creek) -15 -10 -5 0 35 40 45 60m-25-15-5 5 15 Distance (m) 1414 1515 1616 1717 1919 2020 2121 2 5050 2424 2323 4949 1 2 3 4 5 69 8 7 1010 40 m 1212 1313 1 50m 2525 2626 2727 2828 2929 3131 3232 3 3535 3636 30 m 70 m 3434 3737 3838 3939 4141 4242 4343 4040 4 4545 30 25 m 4646 4747 4848 25 3030 Plot 208 (Swale) 1212 1 3 2 4 5 6 78 1 1010 9 1313 1414 1515 1616 1717 1818 2020 2121 2 2323 1919 2424 4949 5050 3737 3838 3939 4040 4141 4242 4646 4343 4 4545 4848 4747 2828 3232 3535 3636 3434 3 3131 2929 3030 2727 2525 2626 -15 -10 -5 0 5 10 15 20 -15-10-505101520 Distance (m) (+,+,+) (+,-,+) (-, -,+) 2005, 2006, 2007 Probability of equal infection in each transect <0.01 Asclepias viridis intensely sampled from 3 plots, (and sequenced from selections of two)

26. Plot200520062007 208Negative Positive (36%,18/50) 307Positive (66%, 33/50) 343PositiveNegative Positive (82%, 41/51) Presence of tymovirus in Asclepias viridis over time and space 343 (+,-) 307 (+,+) 208 (-, -) 208 remote 343 remote

29. Plot 208 (Swale) Distance (m) buffer 12 1 3 2 4 5 6 78 11 10 9 13 14 15 1617 1820 21 22 23 19 24 49 50 37 38 3940 41 42 46 43 44 45 4847 28 32 35 3634 33 31 29 30 27 25 26 -15 -10 -5 0 5 10 15 20 -15-10-5 0 5101520 Distance (m) buffer Tymovirus presence in A. viridis tubers in plot 208 (RT-PCR) (-/-) (+/+) (Plant/ tuber)

30. Virus GenusPlant species# plant specimens # Reads/ specimen Read % AscovirusArtemisia ludoviciana132.0 BadnavirusAmbrosia psilostachya2101.3 Sorghastrum nutans131.0 ChrysovirusAsplenium rhizophyllum12711.9 ComovirusAsclepias viridis140.7 FlexivirusAmbrosia psilostachya29725.4 MetapneumovirusDesmanthus illinoensis131.5 CoccolithovirusFestuca subverticillata120.8 Sorghastrum nutans120.8 RanavirusPanicum virgatum120.7 lambda-like phageAmbrosia psilostachya120.4 TymovirusAmorpha fruticosa120.7 Asclepias viridis1031585.7 Asplenium rhizophyllum13314.6 Cephalanthus occidentalis141.1 Desmanthus illinoensis173.5 Most viruses have relatively low proportion of reads in VLPs Exception: a new tymovirus, but only in Asclepias viridis. Interpretation: high titers

31. Tymovirus reads from Virus-like Particles (positives only) Few reads mean that the genome is poorly sampled

32. RT-PCR from capsid Non-Asclepias

33. Asclepias only Interspecific comparison Capsid comparison

34. Analysis Principal Components Analysis (PCA), with each position represented by four dummy variables (the four nucleotides). AACAAGGACTACGGAGAACCCGTGGAA The realized dimensionality is much less than sequence length x 4, because most positions are not variable.

35. Common to all PCA results ~50% of variation can be explained by the first four axes Axes higher than 2 do not add anything to the interpretation

36. Tymovirus from Asclepias viridis only A group from plot 343 in two different years A group from many locations, including most of plot 307 but one from plot 343, and using three methods Two outlier groups PCA Axis 1 PCA Axis 2

37. Capsid comparison PCA Axis 1 PCA Axis 2 Plot 343 group Plot 307 group Location effects still evident Most non-Asclepias samples are similar to those from plot 307 Asclepias.

38. PCA Axis 1 PCA Axis 2 Interspecific comparisons Some Non-Asclepias might be outliers, but this might be a methodological artifact, and the variation within Asclepias is huge relative to interspecific variation.

39. Outgroup There are relatively few well- supported clades Non-Asclepias samples are all nested within well-supported clades of Asclepias samples Does this imply other non- Asclepias hosts are sinks?

40. Confusions: Why does tymovirus reach high level only in Asclepias? Are non-Asclepias ‘sink’ populations? (note: there are several orders of magnitude more non-Asclepias than Asclepias in the TGPP.) Are there two different strains? How does transmission within and between species occur? (milkweed beetles are specialists) Are the sequence differences phylogenetic? Are there relevant structural differences in the RNA? Is the relationship parasitic, commensal, or mutualistic?