1. 1 Proprietary & Confidential The world leader in serving science Proprietary & Confidential Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus–colonized bulls Lee Effinger Lalitha Peddireddi Marilyn Simunich Richard Oberst Catherine O’Connell Ivan Leyva-Baca Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger) Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX (Leyva-Baca, O’Connell) JVDI, 2014, Vol. 26(1) 72-87

2. 2 Proprietary & Confidential Background 2010 AAVLD parasitology committee Proposed a study to determine whether T. foetus samples can be pooled in order to reduce the costs for testing Lee Effinger from Oregon State Department of Agriculture led Experimental Design for the project Marilyn Simunich Idaho State Department of Agriculture served as Study Coordinator & Data Keeper The Life Technologies Animal Health & Food Safety Group agreed to support the study

3. 3 Proprietary & Confidential Objectives 1.Determine the effect of pooling a single positive sample having various CT ranges with four negative samples (1:5). If a negative effect was seen, a 1:3 pooling study would then be conducted 2.Compare different sample preparation systems and various real-time PCR (feeder lab workflows) with the 5X MagMAX TM -pathogen RNA/DNA purification kit and amplification with VetMAX TM T. foetus reagents (Life Technologies workflow) 3.Assess the specificity of the VetMAX TM T. foetus reagents by sequencing all positive samples with CT values less than 38 and suspect sample CT values between 38 and less than 40 cycles

4. 4 Proprietary & Confidential Materials and Methods Sample collection (Cultured Smegma Samples) 5 Feeder labs provided 803 samples 1 on the West Coast 1 in the Southwest 1 in the Central States 2 in the South Each feeder lab ran their own protocol including sample preparation system and real-time PCR  1 Central Study lab (KSVDL)  Sample preparation with MagMAX TM  Real-time PCR with VetMAX TM T. foetus reagents

5. 5 Proprietary & Confidential Cultured smegma samples provided by feeder labs Sample Matrix Source # of positive samples * # of negative samples* # of inconclusive samples * Total samples submitted Cultured smegma samples (A)733010374 (B)28720100 (C)952263 (D)1733050 (F)341820216 Total1616402803 * As reported by the feeder labs

6. 6 Proprietary & Confidential Real Time PCR Parameters for Feeder Laboratories Lab ALab BLab C Herds 1-2 Lab C Herds 3- 6 Lab DLab FStudy Lab Final reaction volume(µL)20 25 Vol. of T. foetus primer/probe per reaction (µL) 111110.88/1.13-F&R1 Volume of extract per reaction(µL)4488558 Volume Master Mix (µL)15 12.5 1918.7512.5 Primer/probe designMcMillen Vet-Max Modified McMillen Vet-Max Taq usedUniversal qPCR qPCR MM TaqMan Univ.MM Absolute qPCR low rox mix qPCR MM ThermocyclerAB 7500 Cepheid SCAB7500 Thermocycler modeStandard FastStandard Stage 1 temperature(°C) 95 50/9595 Stage 1 time (sec)10 60010120/12015600 Stage2 denaturation (°C) 95 9795 Stage 2 denaturation time (sec)15 22015 Stage 2 annealing temp (°C) 55 60 55 Stage 2 annealing time (sec)45 40456045 # cycles40 4540 Analysis thresholdFixed 2.0 Control based threshold-10% max TF/5% max Xeno Fixed 0.2 Control based threshold- 10% max TF/Xeno Analysis baseline setting3-15 auto Positive (Ct)<35 <36 <38<37<38 Suspect/Inconclusive(CT)35-40 36-40 38-39>3738-40/Xeno 28.5-31.5 Negative(CT)>40 undetectedUndetected/Xeno 28.5-31.5 Internal extraction controlNo Yes <36 CT NoYesYes CT = 28.5-31.5

7. 7 Proprietary & Confidential Results: Individual Sample Testing Study Lab Result / Feeder Lab Result Sample Matrix Lab Source Sample preparation system Pos/PosPos/NegPos/Inc PresPos /Neg Neg/PosNeg/IncNeg/NegTotal Percent agreement Cultured smegma samples ABoiling7150120295374 97.9 BBoiling211000706210083.0 CMagMax922000506396.7 DBoiling17401002850 90.0 FQiagen340010018121 6 99.5 ResultsAll labsMultiple15221239061680395.6 Order of the call = KSVDL Study Lab / Feeder Laboratory Pos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive Study Lab Results vs. Feeder Lab Results

8. 8 Proprietary & Confidential Conclusions Individual Testing 803 smegma samples were provided by feeder labs (FL) All the samples were tested by study laboratory with Life Technologies workflow systems: MagMAX TM VetMAX TM T. foetus reagents Agreement of 95.6% was reached with 768/803 samples between feeder labs and study lab Interestingly, Lab F reached almost 100% agreement using a different sample prep system and a modified McMillen’s assay Study laboratory (KSVDL) with LT protocol identified 24 more positives than the feeder laboratories. On retesting, one of the feeder labs missed 9 samples reported as positives.

9. 9 Proprietary & Confidential Pooling Study Laboratory ID Positive Samples Available Negative Samples Available Negatives Needed Deficit /Surplus of Negative Samples A77297308-11 B3169124-55 C135052-2 D212884-56 F34181136+45 Total176625704 Positives, presumptive positive and negative samples used from each lab for pooling

10. 10 Proprietary & Confidential Pooling results Sample ID*Individual test CT Pooled1:5 Test CT Pooled1:3 Test CT Study lab final call Pooled 1:5 call Pooled 1:3 call 1C-6-1135.05Undetected PositiveNegative 2A-40-535.2037.8337.86Positive 3A-39-235.4135.9334.82Positive 4F-1-735.43 35.53Positive 5F-18-135.5236.1634.75Positive 6C-1-2335.9335.7535.82Positive 7B-8-436.0234.9135.59Positive 8F-19-1036.3033.4832.82Positive 10A-27-936.36Undetected PositiveNegative 9B-4-136.45Undetected PositiveNegative 11C-6-1037.20Undetected37.69PositiveNegativePositive 12A-41-237.8936.92Not testedPositive Not tested 13C-4-5**38.77 (ave of 4)Undetected Positive WFA*Negative 14C-6-15**39.09 (ave of 3)Undetected Positive WFANegative 15A-24-10**39.12 (ave of 2)Undetected Suspect Positive WFA Negative Effect of pooling for T. foetus samples with CT>35 after individual testing *WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing

11. 11 Proprietary & Confidential Pooling results 1:5 Pools 1:5 pooling of positive samples with a CT of 35 and below were all detected Only 3 of 9 positive samples with CTs between 36-39.9 were detected in 1:5 pools Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples 1:3 Pools Only 8 of 15 positive samples with CTs between 36-39.9 were detected in the 1:3 pools 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples

12. 12 Proprietary & Confidential Sequencing primer design for nested PCR (R-TFSM-primer) (O-F-TFSM-Primer) (M13-I-F-TFSM-Primer) (M-13-R-TFSM-primer) TTAGCTTTCTTT GCGA T. foetus TTAGCTAACAAT GCGA S. moskowitzi Primers for Nested PCRAbbreviationPrimer Sequence Forward outer forward primer(O-F-TFSM-Primer)CCTTAGGCAATGGATGTCTTGGC Reverse primer(R-TFSM-primer)GCGCAATGTGCATTCAAAG M13 Forward Inner primer(M13-I-F-TFSM-Primer) TGTAAAACGACGGCCAGTCTTACACGATGAAGAA CGTTGC M13 Reverse primer(M-13-R-TFSM-primer) CAGGAAACAGCTATGACCGCGCAATGTGCATTCA AAG GenBank: GQ254636.1 Simplicimonas moskowitzi GenBank: AY349189.1 Tritrichomonas foetus

13. 13 Proprietary & Confidential Sequencing results for 175 T. foetus positives 175/176 T. foetus positive samples, including three late risers, were confirmed T. foetus by DNA sequencing

14. 14 Proprietary & Confidential Sensitivity, specificity, & predictive values of positive & negative results for all cultured smegma samples CalculationFormulaResult % Sensitivity True Positives True Positives + False Negatives X 100 175_ 175 + 0 x100 100% % Specificity True Negatives True Negatives + False Positives X 100 625___ 625 + 3 x100 99.52% Predictive value of a positive test True Positives True Positives + False Positives X 100 175__ 175 + 3 x100 98.31% Predictive value of a negative test True Negatives True Negatives + False Negatives X 100 625__ 625 + 0 x100 100% * Calculations made after qPCR and sequence confirmation

15. 15 Proprietary & Confidential Sequencing Results 175/176 positive samples by qPCR were able to be sequenced 1 sample (A-7-25) with a CT 33.95 was not able to be sequenced. It is possible that there are point mutations in this positive sample in the sequencing primer regions, which were designed based on a few T. foetus and a single S. moskowitzi sequences from GenBank Most importantly, none of the samples reported S. moskowitzi DNA sequences

16. 16 Proprietary & Confidential Overall results 95.6 % agreement was reached between Study Lab (KSVDL) using Life technologies MagMAX TM and VetMAX TM T. foetus reagents and the feeder laboratories 1:5 Pooling it is likely to miss 4% of the positives 1:3 Pooling it is likely to miss 3.5% of the positives DNA sequencing 175/176 positive samples were confirmed to be T. foetus, the 176 th sample could not be sequenced with the primers designed for this study

17. 17 Proprietary & Confidential Acknowledgements Lalitha Peddireddi, KSVDL – performed the study at KSVDL Lee Effinger, ODA-Animal Health Laboratory Marilyn Simunich, Idaho State Dept. of Agriculture Cate O’Connell, Life Technologies Mangkey Bounpheng, Texas Veterinary Medical Diagnostic Laboratory Dawn Bueschel, NMDA Veterinary Diagnostic Services Muthu Chengappa, Kansas State Veterinary Diagnostic Laboratory Alfonso Clavijo, Texas Veterinary Medical Diagnostic Laboratory Kris A. Clothier, California Animal Health & Food Safety Lab System Hemant K. Naikare, Texas Veterinary Medical Diagnostics Laboratory Jeff Zinza, Life Technologies Mary Anne Williams, Life Technologies