1. Molecular networks regulated by tumor suppressive microRNA-375 in head and neck squamous cell carcinoma Abstract #137 Takashi Kinoshita 1,2, Toyoyuki Hanazawa 1, Nijiro Nohata 1,2, Naoko Kikkawa 1, Miki Fuse 2, Takeshi Chiyomaru 3, Hirofumi Yoshino 3, Hideki Enokida 3, Masayuki Nakagawa 3, Yoshitaka Okamoto 1, Naohiko Seki 2 1 Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3 Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan MicroRNAs (miRNAs) constitute a class of small non-protein coding RNA molecules, 19 – 22 nucleotides in length. They negatively regulate multiple genes by mRNA cleavage or translational repression. Down-regulated miRNAs in cancer cells could function as a tumor suppressors by negatively regulating oncogenes. Our miRNA expression signatures of hypopharyngeal squamous cell carcinoma (HSCC), maxillary sinus squamous cell carcinoma (MSSCC) and esophageal squamous cell carcinoma (ESCC) revealed that microRNA-375 (miR-375) was significantly down-regulated in cancer tissues compared to normal epithelium. The aim of this study was to clarify the functional significance of miR-375 and to identify the gene targets miR-375 regulates in head and neck squamous cell carcinoma (HNSCC). Background and Aims 1. qRT-PCR revealed that miR-375 was down-regulated in HNSCC tissues compared with adjacent normal epithelium in 20 patients with HNSCC. 2. Gain-of-function analysis revealed that cancer cell proliferation was inhibited and apoptosis was induced in miR-375 transfected HNSCC cells. 3. Genome-wide molecular targets search and TargetScan database indicated that LDHB (lactate dehydrogenase B) and MTDH (metadherin) were candidate genes of miR-375 target. 4. qRT-PCR, Western blots, and luciferase assays revealed that miR-375 directly inhibits LDHB and MTDH expression. 5.LDHB, which is the glycolytic enzyme that catalyze the formation of lactic acid from pyruvate, promotes cell proliferation in HNSCC. 6.MTDH, which promotes tumorigenesis by modulating multiple signal transduction pathways such as NF- κB, PI3K/AKT, and Wnt pathway, promotes cell proliferation in HNSCC. Key Findings Conclusions miR-375 functions as a tumor suppressor in HNSCC. LDHB and MTDH are directly regulated by miR-375. These genes may function as oncogenes and contributed to cell proliferation in HNSCC. Tumor suppressive miR-375 and its target oncogenes may provide new insights into the molecular networks of HNSCC. References 1.Tumor suppressive microRNA-375 regulates oncogene AEG-1 /MTDH in head and neck squamous cell carcinoma (HNSCC) Journal of Human Genetics, 2011 56:595-601. 2.Tumor suppressive microRNA-375 regulates lactate dehydrogenase B in maxillary sinus squamous cell carcinoma International Journal of Oncology, 2012 40:185-93. Top 10 down-regulated miRNAs from TaqMan LDA in MSSCC No.miRNA Fold Change P-value 1miR-10.0072.40E-02 2miR-3750.0337.25E-05 3miR-139-5p0.0921.52E-04 4miR-5040.1471.20E-02 5miR-125b0.2327.15E-04 6miR-199b0.2686.53E-03 7miR-1000.2742.76E-03 8miR-4970.2787.15E-04 9let-7c0.2823.66E-03 10miR-30a*0.3181.20E-02 No.miRNA Fold Change P-value 1miR-8740.0114.63E-02 2miR-133a0.0173.30E-03 3miR-3750.0351.61E-02 4miR-2040.0455.50E-03 5miR-10.0542.40E-02 6miR-139-5p0.1324.40E-03 7miR-1450.1673.67E-02 8miR-1430.1771.90E-02 9miR-486-3p0.1834.07E-02 10miR-146a0.2534.10E-03 Top 10 down-regulated miRNAs from TaqMan LDA in HSCC 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 NormalTumor P=0.008 miR-375 expression (Normalized to RNU48 ) mock control Early apoptosis cell (relative to mock) miR-375 0 0.5 1.0 1.5 2.0 2.5 * mock control Cell proliferation (% of mock) miR-375 0 20 40 60 80 100 * SAS No. Gene Gene Name log2 ratiomiR-375 SymbolSASFaDuAveragetarget site 1HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 -1.71-4.12-2.92+ 2PDIA4protein disulfide isomerase family A, member 4-1.79-3.04-2.41- 3HSPA5heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)-1.44-3.22-2.33- 4LDHBlactate dehydrogenase B-2.19-2.28-2.24+ 5NUCB2nucleobindin 2-1.8-2.57-2.18- 6PSIP1PC4 and SFRS1 interacting protein 1-1.8-2.53-2.17+ 7CXCR7chemokine (C-X-C motif) receptor 7-2.56-1.63-2.1- 8MTDHmetadherin-1.71-2.44-2.07+ 9SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 -1.23-2.81-2.02+ 10KRT5keratin 5-1.93-2.1-2.01- 11YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide -1.9-2.08-1.99+ 12DNAJB11DnaJ (Hsp40) homolog, subfamily B, member 11-1.4-2.22-1.81- 13KRT8keratin 8-1.78-1.76-1.77- 14HSP90B3Pheat shock protein 90kDa beta (Grp94), member 3 (pseudogene)-1.21-2.32-1.77- 15EBPLemopamil binding protein-like-1.78-1.67-1.73+ 16C6orf129chromosome 6 open reading frame 129-1.48-1.95-1.72- 17TTC7Btetratricopeptide repeat domain 7B-1.44-1.98-1.71+ 18HSP90B1heat shock protein 90kDa beta (Grp94), member 1-1.08-2.3-1.69- 19C4orf3chromosome 4 open reading frame 3-1.49-1.88-1.69- 20SDF2L1stromal cell-derived factor 2-like 1-1.14-2.15-1.65- 0.20 0.15 0.10 0.05 0 NormalTumor P=0.014 Normalized to GAPDH LDHB miR-375 expression in 20 pairs of HNSCC samples miR-375 inhibited cancer cell proliferation and induced apoptosis Top 20 down-regulated genes by transfection of miR-375 in HNSCC cell lines MTDH NormalTumor 0.10 0.08 0.06 0.04 0.02 0 P=0.015 Normalized to GAPDH HERPUD1 0.18 Normal 0.16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0 Tumor P=0.12 Normalized to GAPDH PSIP1 0.30 0.25 0.20 0.15 0.10 0.05 0 NormalTumor P=0.16 Normalized to GAPDH SLC7A11 0 NormalTumor 0.020 0.005 0.010 0.015 P=0.38 Normalized to GAPDH The mRNA expression of candidate genes for miR-375 target in 20 pairs of HNSCC samples * P<0.0001 Cell proliferation (% of mock) 0 20 40 60 80 100 * SAS * mock si-control si-MTDH_1 si-MTDH_2 WT-3’UTR Luminescence (normalized) 0 0.2 0.4 0.6 0.8 1.0 1.2 * DEL-3’UTR MTDH (NM_178812) 3’UTR length:1637 miR-375 target site1454-1460 Position 1454-1460 of MTDH 3’UTR 5‘...ACUAGGAAAGCUAAACGAACAAA... ||| ||||||| 3’ AGUGCGCUCGGCUUGCUUGUUU 5‘...ACUAGGAAAGCUAAA-------A... ||| ||||||| 3’ AGUGCGCUCGGCUUGCUUGUUU Position 1454-1460 deletion MTDH mRNA expression (% of mock) 0 20 40 60 80 100 * 120 MTDH normalized to β-Actin MTDH β-Actin SAS 0 20 40 60 80 100 120 mock control miR-375 mockcontrolmiR-375 miR-375 directly regulates MTDH expression both in mRNA and protein levels Knocking down of MTDH inhibited cancer cell proliferation * P<0.0001