Presentation is loading. Please wait.

Presentation is loading. Please wait.

FALL 2014 HORT6033 MOLECULAR PLANT BREEDING Instructor: Ainong Shi HORT6033 web site:

Similar presentations


Presentation on theme: "FALL 2014 HORT6033 MOLECULAR PLANT BREEDING Instructor: Ainong Shi HORT6033 web site:"— Presentation transcript:

1 FALL 2014 HORT6033 MOLECULAR PLANT BREEDING Instructor: Ainong Shi HORT6033 web site:

2 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 2 (08/25/2014) I.Say Hello Each Other (5 min) II. Estimation Question Discussion (5 min) III. PCR and Primer Design (30 min) IV. Research Project and Homework (8 min) V.Questions (2 min)

3 I. Say Hello NameMajor Marlovi Andrea Acuna Abeer Muhammedali Jasim Al- Nasrawi FNU Anuj Jessica L Marcos Paulo Da Mirta Beatriz Terrence James Clinton Philip Ashley Elizabeth Avjinder Singh Mariola Laura Melissa Lara Jennifer Anne Cindy Massiel Lopez Dennis Nicuh Bulusan Reiofeli Algodon Shilpa Vijay Brant Michael Janithri S. Name Jianbing Ma Weiguo Lu Haizheng Xiong Jun Qin Long Yan Maria Nelly Arguello Blanco Liliana Florez-Palacios Good morning, everyone! Nice to see you again! I am Ainong Shi, as you know, the teacher for this class. I speak “Chinese English” in the class, and apologize for my strong accent. I am the vegetable breeder in the Department of Horticulture. My hobby is “ watching Chinese Kung Fu Movies”. Please introduce yourself!

4 Fall 2014 HORT6033 Molecular Plant Breeding II. Estimation Question Discussion (5 min) Click HERE for the Questions!HERE Click Here for Question Answer!Here

5 III. PCR and Primer Design 1. PCR Fig from https://www.neb.com/) Developed in 1983 by Kary Mulli, who won the Noble Prize for the PCR technology. PCR (polymerase chain reaction) is a technology used to amplify a single copy of DNA segment to millions of copies. And then you can see by eyes or machines. The PCR reaction consists of Denaturation, Annealing, and Extension.

6 III. PCR and Primer Design 2. PCR Primer Design Dozens of PCR primer design programs and tools are available for free to use from the Internet. We only discuss three tools: BatchPrimer3 Primer-BLAST SSRLocator Example 1: One cowpea EST multiple alleles Example 2: cowpea ESTs with SNPs mapped to the cowpea genetic maps Example 3: Tomato Mosaic Virus resistance gene Tm-2 multiple alleles format >FG938745_UCRVU09_UCR 707 TTTTTTTTTTTTTTTTTACCCAGAAACAGCTTAGAGCGTGAAAGCAAACACTAATGAACAAACCTTGAAAA GGCTTTATATATATACACAGTACACTTAGCAAAAGCACGCCCATACCTGCGTTTTTACATATTTACATCT AACCGACCATAACCATAAACACTGGACAAACTAAGACTCAGCTGTTAAACCACACAAAGCTACC ACCATTTCAACCGCTTAACTCATGAACTCATACATATATATATATATATATATATATATATATATATATATATAC ACACACATATATATGCACAAAAAGGTAAACAAAAATGATACAGCATGACCAAAAAAGGCAGAGG AAAGCAAACTATATTTTCATTCTTTTAGTGATCATGGAGAGTCATTTCTCACACATCGAAAGGAGAAGA AGAGCTTGGTCTGTTCTGGCGAGTCTTCTCGAACGCATCCGATGTCGACCTTCTTCGAAACCGGAA GGACTCTCTAGCTCCTGAAAACGGAGACACCGGAGGAGTAGAACCGGCGGGTGAAGCCGGC GCCGATCCACTCTGACTCTGATATCCGGGTGGCTTCACGATCATGATACTACGTGTAACTCTCATCG CGTCTTCCGGCGAATCCTCACCGTATGACTTCA CGCTTCCGCCGTCTGATTCCTTGCCAGAG

7 Primer Design using Primer-BLAST Design PCR primers using Primer3 and search the forward and reverse primers in all available in GenBank. Shi et al Molecular Markers for Tm-2 Alleles of Tomato Mosaic Virus Resistance in Tomato American Journal of Plant Sciences 2: [pdf]pdf For example: Tomato Mosaic Virus resistance gene tm2,Tm-2, and Tm-2a [fasta]fasta

8 Primer Design using BatchPrimer3 BatchPrimer3 is a tool for designing various primers including for SSRs It can be used for SSR discovery as well Tool website: Web tool: gi-bin/batchprimer3/batchprimer3.cgi gi-bin/batchprimer3/batchprimer3.cgi Examples cowpea_EST_1_0693.fasta Pick up part of the EST sequences from below file, cowpea_SSR_SNP_geneticMap_marker.fasta cowpea_SSR_SNP_geneticMap_marker.fasta

9 Primer Design using SSRLocator u.br/faem/fitotecnia/ fitomelhoramento/fal econosco.html  Install SSRLocator in C: as showing C:\SSRLocatorI  Copy your data file with fasta format (.fasta) into the SSRLocatorI folder such as “cowpea_EST_1_0693.fasta”  Open SSRLocatorI.exe  Format file to SSRLocator Standard in the “Create File” button. Save a new file called “cowpea_EST_1_0693format.fasta”  And more ……. aem/fitotecnia/fitomelhora mento/faleconosco.html Linked

10 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 2 (08/27/2014) IV. Project and Homework The research project for the Fall Semester, 2014 will be 1. SSRs and SNPs discovery and validation in chicory or other crops; 2. Genetic diversity in cowpea or other crops; 3. Trait : markers association analysis in cowpea; 4. Association mapping in spinach or other crops; and 5. QTL mapping for downy mildew resistance in spinach or others. [pdf]pdf You can work your own project! Each Student will work one more project.

11 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 2 (08/27/2014) Homework 1. Discuss SSRLocator installation 2. Discuss how to download cowpea ESTs from GenBank 3. Design allele-specific primers for tm-2, Tm-2, and Tm-2a 4. Read the article Shi et al American Journal of Plant Sciences 2: [pdf]pdf


Download ppt "FALL 2014 HORT6033 MOLECULAR PLANT BREEDING Instructor: Ainong Shi HORT6033 web site:"

Similar presentations


Ads by Google