Presentation is loading. Please wait.

Presentation is loading. Please wait.

Disorders of structural proteins Fransiska Malfait Anne De Paepe.

Similar presentations


Presentation on theme: "Disorders of structural proteins Fransiska Malfait Anne De Paepe."— Presentation transcript:

1 Disorders of structural proteins Fransiska Malfait Anne De Paepe

2 Defects of dystrophin A spectrum of muscle disease caused by mutations in the DMD gene, which encodes the protein dystrophin. The mild end of the spectrum asymptomatic increase in serum concentration of creatine phosphokinase (CK) muscle cramps with myoglobinuria isolated quadriceps myopathy The severe end of the spectrum: progressive muscle diseases Duchenne/Becker muscular dystrophy (skeletal muscle) DMD-associated dilated cardiomyopathy (heart)

3 Duchenne muscular dystrophy (DMD) Normal for the first two years of life Symptoms present before age 5 years Progressive symmetrical muscular weakness, proximal greater than distal, often with calf hypertrophy Wheelchair-dependency before age 13 years Unlikely to survive beyond age of 20 years Die of respiratory failure or cardiomyopathy Modest decrease in IQ (~20 points) Prevalence: 1/5,000 males

4 Becker muscular dystrophy (BMD) Progressive symmetrical muscle weakness and atrophy, proximal greater than distal, often with calf hypertrophy (weakness of quadriceps femoris may be the only sign) Activity-induced cramping (present in some individuals) Flexion contractures of the elbows (if present, late in the course) Wheelchair dependency (if present, after age 16 years) Preservation of neck flexor muscle strength (differentiates BMD from DMD) Prevalence: 1/18,000 males

5 DMD-associated dilated cardiomyopathy Dilated cardiomyopathy (DCM) with congestive heart failure, with males typically presenting between ages 20 and 40 years and females presenting later in life Usually no clinical evidence of skeletal muscle disease; may be classified as "subclinical" BMD Rapid progression to death in several years in males and slower progression over a decade or more in females

6 Molecular Genetics: inheritance Incidence DMD: ‣ 1:3300 live male births ‣ Calculated mutation rate ‣ Given a sperm production rate of 8x10 7 sperm/day: sperm with new mutation is produced every 10 seconds by normale male!

7 Molecular Genetics: inheritance X-linked recessive disorder (Xp21.2) 1/3 of cases: new mutations 2/3 have carrier mother

8 Molecular Genetics: inheritance Carrier mother: ‣ majority: no clinical manifestations ‣ 70 % has slightly elevated serum creatine kinase ‣ Random inactivation of X-chromosome  ‧ ~19 % of adult female carriers have some muscle weakness ‧ 8% has life-threatening cardiomyopathy and severe muscle weakness Females with DMD (rare): ‣ Nonrandom X-inactivation ‣ Turner syndrome (45,X) ‣ X; autosome translocation

9 Molecular Genetics: inheritance DMD Lethal gene is not transmitted 1/3 of cases: new mutations 2/3 have carrier mother BMD Non-lethal gene is transmitted high proportion of BMD cases is inherited, only 10% new mutations

10 Molecular Genetics Gene: DMD ‣ the largest known human gene (1,5% of X-chromosome) ‣ 2.4 Mb of DNA ‣ comprises 79 exons ‣ at least four promoters ‣ differential splicing  tissue-specific, developmentally regulated isoforms Protein: dystrophin ‣ part of a protein complex that links the cytoskeleton with membrane proteins that in turn bind with proteins in the extracellular matrix ‣ expressed in skeletal and cardiac muscle, brain

11

12 Dystrophin complex:major functions maintenance of muscle membrane integrity correct positioning of proteins in the complex, so that they function correctly ion channels and signaling molecules  participation in cell-cell and/or cell-substrate recognition

13 Genotype-phenotype correlations lack of dystrophin expression: DMD ‣ very large deletions  absence of dystrophin expression ‣ mutations that disrupt reading frame (stop mutation, splicing mutation, deletion, duplication)  severely truncated dystrophin that is degraded remaining dystrophin production (abnormal quality or quantity): BMD ‣ deletions or duplications that juxtapose in-frame exons ‣ some splicing mutations ‣ most non-truncating single-base changes that result in translation of a protein product with intact N and C termini.

14 Molecular Genetics Molecular defectFrequencyPhenotype Affected males Gene deletion (1 exon to whole gene) 60%DMD or BMD Point mutation34%DMD or BMD Partial gene duplication6%DMD or BMD Contiguous gene deletionRareDMD + other phenotypes Affected females Nonrandom X-inactivationRareDMD Turner syndrome (45,X)RareDMD X; autosome translocationRareDMD

15 Molecular Genetics Distribution of deletions: clustered in 2 regions ‣ 5’ half (exon 2-20) (30%) ‣ exons (70%)

16 Reading frame hypothesis

17 Testing Electromyography: to differentiate between myopathy and neurogenic disorder Serum Creatine Phosphokinase (CK) Concentration phenotype% of affected individuals Serum CK conc. MalesDMD100%> 10x normal BMD100%> 5x normal DMD-associated DCM Most individuals“increased” Female carriers DMD~50%2- 10x normal BMD~30%2- 10x normal

18 Testing Western Blot and immuno-histochemistry PhenotypeWestern BlotImmunohistochemsitry Dystrophin molecular weight Dystrophin quantity MalesDMDNon-detectable0%-5%(almost) complete absence IntermediateNormal/Abnormal5%-20% BMDNormal Abnormal 20%-50% 20%- 100% Normal appearing or reduced intensity ± patchy staining Female carriers DMD Random XCINormal/Abnormal> 60%Mosaic pattern DMD Skewed XCINormal/Abnormal< 30%Mosaic pattern

19 immuno-histochemistry Localisation of dystrophin to myocyte membrane DMD: Absence of dystrophin in myocyte membrane

20 Testing Molecular genetic testing ‣ Deletion/duplication analysis ‧ Multiplex PCR, southern blotting and FISH (deletions) ‧ Southern blotting and quantitative PCR (duplications) ‧ MLPA (deletions/duplications) ‣ Mutation scanning and sequence analysis ‧ Small deletions/insertions, single base changes, splice mutations

21 Multiplex PCR Multiplex PCR analysis of dystrophin gene deletions. Exons A, B, C, and D are amplified in a single PCR reaction (arrows indicate PCR primers). The products (shown below each exon) are separated by size on an agarose gel and are visualized

22 Multiplex PCR Multiplex PCR analysis of exons 51, 12, 44, and 4 of the dystrophin gene. Bands corresponding with each exon are indicated at the right. Patient sample is in lane 2, showing an exon 51 deletion. Lane 1 is a control, showing all four bands. Other lanes contain samples for other males.

23 Genetic counseling The father of an affected male will not have the disease nor will he be a carrier of the mutation. A woman with an affected son and one other affected relative in the maternal line is an obligate heterozygote. A woman with more than one affected son and no other family history of a dystrophinopathy has either: ‣ A germline mutation (i.e., a DMD disease-causing mutation present in each of her cells); or ‣ Germline mosaicism (i.e., mosaicism for a DMD disease-causing mutation that includes her germline)

24 Genetic counseling If the proband is the only affected family member 1.the proband has a de novoDMD disease-causing mutation as a result of one of the following: ‣ The mutation occurred in the egg at the time of the proband's conception and is therefore present in every cell of the proband's body. In this instance, the proband's mother does not have a DMD disease-causing mutation and no other family member is at risk. ‣ The mutation occurred after conception and is thus present in some but not all cells of the proband's body (somatic mosaicism). In this instance, the likelihood that the mother is a heterozygote is low.

25 Genetic counseling 2.the proband's mother has a de novoDMD disease-causing mutation. Approximately 2/3 of mothers of males with DMD and no family history of DMD are carriers. The mechanisms by which a de novoDMD disease-causing mutation could have occurred in the mother are the following: ‣ The mutation occurred in the egg or sperm at the time of her conception (germline mutation) and is thus present in every cell of her body and detectable in DNA extracted from leukocytes. ‣ The mutation is present in some but not all cells of her body (somatic mosaicism) and may or may not be detectable in DNA extracted from leukocytes. ‣ The mutation is present in her egg cells only (termed "germline mosaicism") and is not detectable in DNA extracted from a blood sample. The likelihood of germline mosaicism in this instance is 15%- 20%. Consequently, each of her offspring has an increased risk of inheriting the DMD disease-causing mutation

26 Genetic counseling 3. The proband's mother has inherited a DMD mutation from one of the following: ‣ Her mother, who is a carrier ‣ Her mother or her father, who has somatic mosaicism ‣ Her mother or her father, who has germline mosaicism

27 Two types of pedigrees encountered in families with Duchenne or Becker dystrophy. mother has a 66% risk of being a carrier, and his sister, therefore, a 33% risk two obligate carrier females and a woman at 50% risk based on family history.

28 Variable degree of bone fragility 4 subtypes (Sillence et al. 1979, 1984) Type IMild Type IILethal Type IIISevere Type IVModerate Defects of type I collagen Due to mutations in COL1A1/COL1A2 Mutations in collagen structural genes: Osteogenesis imperfecta

29

30 Mild OISevere OILethal OI

31 Type I collagen Great potential for mutations Complex gene structure = 36 bp = 45 bp = 54 bp = 90 bp = 99 bp = 108 bp = 162 bp Most abundant fibrillar collagen in body Widely expressed in bone, tendon, skin, other tissues Heterotrimer:2  1 chains  COL1A1 (chr 17) 1  2 chain  COL1A2 (chr 7)

32 N-terminus Cleavage by N-proteinase Cleavage by C-proteinase Gly AMINOACID SEQ MOLECULE Type I procollagen MOLECULAR PACKING COLLAGEN FIBRIL Collagen Fibrillogenesis

33 Collagen structure

34 Collagen biosynthesis

35 Collagen fibrillogenesis PPCC

36 Molecular abnormalities of collagen in OI diminished type I collagen production structurally defective collagens

37 Osteogenesis imperfecta type I (mild)  2(I)  1(I)  1(III) 3 Normal Mutant GCCCTTGTGGAGCGAGAGGT GlyGluGlyValProArg GCCCTTGTGGAGTGAGAGG T GlyGluGlyValPro STOP  1(I) - Arg 240 Stop (CGA  TGA) CPCC

38 Osteogenesis imperfecta type I (mild)

39 Osteogenesis imperfecta type II-IV  2(I)  1(I) GGA > GAA  1(I) - Gly286Glu  1(I) M  2(I) M GlyProAlaGlyGlu Gly ProAlaGlu 2 86 Glu Gly PPCC medium collagens

40 Osteogenesis imperfecta type II-IV Majority: glycine substitutions in triple helical domain of either the pro-α1 or pro- α2 chain of type I collagen Phenotypic determinants include: ‣ Which chain is involved (α1(I) vs α2(I)-collagen chain) ‣ Location of substitution ‣ Nature of substituting residue splice site mutations ‣ Exon skips (in-frame) ‣ Intronic inclusion ‣ Activation of cryptic splice sites

41 Genotype-phenotype correlations α1(I)- chain: ‣ Glycine-substitutions in N-terminal 200 residues are associated with non-lethal phenotype ‣ C-terminal glycine substitutions are associated with severe to lethal phenotype ‣ Two exclusive “lethal regions” α2(I)-chain ‣ 80 % of glycine substitutions is non-lethal ‣ 8 “lethal regions”

42 Distribution of mutations along α1(I)- collagen chain Valine: branched non-polar side-chain Arg, Asp, Glu Charged AA Overrepresentation of lethal phenotypes

43 Distribution of mutations along α2(I)- collagen chain Arg, Asp, Glu Charged AA Overrepresentation of lethal phenotypes

44 Dominant negative effect

45 Genetic counseling Mild OI: ~60% of individuals with mild OI have de novo mutations Severe (type III) and lethal (type II) OI: virtually 100% of individuals with have de novo mutations.

46 Genetic counseling OI typeInheritance patternGeneRecurrence risk IADCOL1A1 COL1A2 50% IIAD (de novo mutation)COL1A1 COL1A2 ~5% (germline mosaicism) IIIAD (de novo mutation)COL1A1 COL1A2 ~5% (germline mosaicism) IVADCOL1A1 COL1A2 50% VAD?50% VIUncertain? VIIARCRTAP25% VIIIARP3H125%

47

48 Collagen biosynthesis

49 Recessive OI: CRTAP/LEPRE/PPIB complex α 1(III) 3 α 1(I) α 2(I) F P M F P M

50 Proband 1Proband 2 Proband 3 Proband 4 Lack of calvarial ossification Beaded ribs with multiple fractures Platyspondyly Shortened, wide, bowed and fractured large tubular bones Recessive OI or Severe/Lethal Autosomal Dominant OI ?? Hom. c.628C>T (p.Arg210X) Hom. c delAGinsC (p.Glu455fs) Het. c.1102C>T (p.Arg368X) Het. c G>A, Intron 14 Hom. c G>A, Intron 14 Recessive OI due to LEPRE1 mutations

51 Complete disappearance of the popcorn-like structures Extreme osteoporosis Widening of the rhizomelic diaphyses Progressive narrowing and bowing of the mesomelic diaphyses Reduced knee joint spaces Long hands with hyperlax finger joints P3 at age 17 years III


Download ppt "Disorders of structural proteins Fransiska Malfait Anne De Paepe."

Similar presentations


Ads by Google