Presentation is loading. Please wait.

Presentation is loading. Please wait.

International Meta-Analysis of HIV Host Genetics Thomas R. O’Brien Division of Cancer Epidemiology and Genetics October 6, 2005.

Similar presentations


Presentation on theme: "International Meta-Analysis of HIV Host Genetics Thomas R. O’Brien Division of Cancer Epidemiology and Genetics October 6, 2005."— Presentation transcript:

1 International Meta-Analysis of HIV Host Genetics Thomas R. O’Brien Division of Cancer Epidemiology and Genetics October 6, 2005

2

3

4 Meta Analysis of Individual Patient Data Include all published and unpublished data –Comprehensive –Reduce publication bias Standardized protocol –Reduce technical variability

5 Purpose Synthesize all available data on the effects of CCR5-∆32, CCR2-64I and SDF-1 3’A alleles on HIV-1 disease progression

6 Genotypic Comparisons European ancestry CCR5 +/  32 & CCR2 +/+ CCR5 +/+ & CCR2 64I/+ or 64I/64I CCR5 +/  32 & CCR2 64I/+ or 64I/64I CCR5 +/+ & CCR2 +/+ African ancestry CCR2 +/64I or CCR2 64I/64I CCR2 +/+ Both groups SDF1 3’A/3’A SDF1 3’A/+ or SDF1 +/+ Allele Frequencies: European ancestry CCR5  32 ~10% CCR2 64I ~10-15% SDF1 3’A ~20% African ancestry CCR5  32 ~1.7% CCR2 64I ~10-15% SDF1 3’A ~6%

7 Meta-Analysis Database Studies from United States, Europe and Australia 1,746 seroconverters from 10 cohorts –581 AIDS cases –972 with data on early HIV RNA level 2,764 seroprevalent subjects from 12 cohorts

8 Standardization of Data Seroconverters –Seroconversion defined as mid-point between the last HIV-1-negative and first HIV-1-positive visit –Both specimens obtained after enrollment in prospective cohort Seroprevalent subjects –Time-scale originating at date of study entry Follow-up censored as of January 1, 1996 Communications between coordinating center and contributing investigators to verify that data adhered to common definitions of the meta-analysis

9 Standardization of Phenotypes AIDS –1987 CDC definition Death HIV-1 RNA level –Consistent lab method and specimen (serum or plasma) within each study –Measured 6 to 42 months after seroconversion

10 Standardization of Genotypes Not attempted

11 Effects of CCR5-  32, CCR2-64I and SDF-1 3’A Alleles on HIV-1 Disease Progression: An International Meta-Analysis of Individual-Patient Data JOHN P.A. IOANNIDIS, PHILIP S. ROSENBERG, JAMES J. GOEDERT, LESLEY J. ASHTON, SUSAN P. BUCHBINDER, ROEL A. COUTINHO, JESPER EUGEN-OLSEN, TERESA GALLART, TERESE L. KATZENSTEIN, LEONDIOS G. KOSTRIKIS, HARMJAN KUIPERS, LESLIE LOUIE, SIMON A. MALLAL, JOSEPH B. MARGOLICK, OLGA P. MARTINEZ, LAURENCE MEYER, NELSON L. MICHAEL, STEPHEN J. O’BRIEN, EVA OPERSKALSKI, GIUSSEPPE PANTALEO, G. PAOLO RIZZARDI, HANNEKE SCHUITEMAKER, HAYNES W. SHEPPARD, MICHAEL W. SMITH, GRAEME J. STEWART, IOANNIS D. THEODOROU, HENRIK ULLUM, ELISA VICENZI, DAVID VLAHOV, DAVID WILKINSON, CASSY-WORKMAN, JEAN-FRANCOIS ZAGURY, and THOMAS R. O'BRIEN for the INTERNATIONAL META-ANALYSIS of HIV HOST GENETICS Ann Intern Med, 2001

12 CCR5-  32 Heterozygotes Relative Hazard for AIDS

13 CCR2-64I Carriers Relative Hazard for AIDS

14 CCR2-64I Carriers Mean Difference in HIV RNA

15 SDF1 3’A Homozygotes Relative Hazard for AIDS

16 Summary Both CCR5-  32 and CCR2-64I – Confer ~25% reduction in the risk of AIDS – Associated with significantly lower HIV RNA No consistent evidence of protection for SDF1-3’A/3’A

17 HIV-1 Meta-Analyses Meta-analysis of individual participants' data in genetic epidemiology Am J Epidemiol, 2002 Effects of CCR5-∆32 & CCR2-64I alleles on HIV-1 disease progression: The protection varies with duration of infection AIDS, 2003 Effect of CCR5-Δ32 heterozygosity on the risk of perinatal HIV-1 infection: a meta-analysis JAIDS, 2003 Effects of CCR5- Δ32 and CCR2 64I alleles on disease progression of perinatally HIV-infected children: an international meta-analysis AIDS, 2003

18

19 CCR5-  32 Heterozygotes Mean Difference in HIV RNA

20 Relative Hazard for AIDS CCR2-64I in Seroconverters

21 Relative Hazard for AIDS SDF1 3’A/3’A (Log scale)

22

23 CCR5-  32 ALLELE Wild type ATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAA ∆32 ATACA TTAAA


Download ppt "International Meta-Analysis of HIV Host Genetics Thomas R. O’Brien Division of Cancer Epidemiology and Genetics October 6, 2005."

Similar presentations


Ads by Google