Presentation is loading. Please wait.

Presentation is loading. Please wait.

Medical Genetics. Medical Genetics "Genetics" Fields: Heredity and its variation. Subfields: - "Human Genetics”: denotes the science of heredity.

Similar presentations


Presentation on theme: "Medical Genetics. Medical Genetics "Genetics" Fields: Heredity and its variation. Subfields: - "Human Genetics”: denotes the science of heredity."— Presentation transcript:

1

2 Medical Genetics

3 "Genetics" Fields: Heredity and its variation. Subfields:
- "Human Genetics”: denotes the science of heredity and its variation in human. - ”Medical Genetics”: deals with human genetic variations of medical relevance / significance .

4 Molecular and biochemical
Medical Genetics subgroups Clinical Genetics- concerned with Clinical manifestation Of genetic diseases Immunogenetics - the study of the genetics of the immune system Molecular and biochemical genetics - the study of the structure and function of individual genes. Cytogenetics - the study of the structure of chromosomes. Population genetics - the study of genetics of populations. . Genetic epidemiology - the study of epidemiology of genetic disease.

5 A brief History of Genetics

6 Historical * Engravings (around 6,000 years)
-Showed pedigree documenting the transmission of certain characteristics of some animals. *Aristotle and Hippocrates -Human characteristics determined by the semen (utilising the menstrual blood as a culture medium and uterus as an incubator). -Semen was thought to be produced by the whole body and hence it was explained that 'baldheaded fathers’ had 'baldheaded' sons. * 17th century -‘Sperm' and 'ovum' were recognised by Dutch scientists and it was explained that female could also transmit characteristics to her offspring. (Contd)

7 Historical (Conti.) * 18th and 19th centuries * 19th century
-There was a revival of interest in heredity and it was shown that several traits such as extra digits (polydactyly) were inherited in different ways. * 19th century -Joseph Adams published "A treatise on the Supposed Hereditary Properties" and indicated different mechanisms of inheritance. -This book was intended as a basis for genetic counselling.

8 * In 1865, Gregor Mendel Historical (Conti.)
- An Austrian Monk, published his results of breeding experiments on Garden Peas. - His work can be considered as the discovery of `genes' (traits) and how they are inherited. - He put forward patterns of inheritance of various characteristics and single gene disorders. -These are known as ‘Mendels Laws of Inheritance.

9 Historical (Conti.) * Mendel showed that some characteristics were:
-"dominant" (e.g.tall height), - others were "recessive“ (e.g. short height). -each characteristic was controlled by a pair of "factors". * In 1909, a Danish botanist, Johannsen, named the hereditary factors as ‘genes’. - two identical genes was referred to as `homozygous', - two different genes for the same characteristic, were called `heterozygous'.

10 Historical (Conti.) Multiple forms of the same gene that occupy the same loci and give rise to different forms of the same characteristics are referred to as allelomorphs"or alleles Alleles Homozygous Heterozygous

11 rediscovered by three workers:
Historical (Conti.) * The 20th century ( development of genetics): - Mendels Laws were independently rediscovered by three workers: - Hugo De Vries ( in Holland) - Carl Correns (in Germany) and - Erich Von Tschermakin (in Austria).

12 Historical (Conti.) * In 1902 :
- Archibald Garrod and William Bateson (fathers of Medical Genetics), discovered `Alkaptonuria' and recognized it as an inherited disorder involving chemical processes. - Garrod called it an "Inborn Errors of Metabolism” - Todate several thousand of such disorders have been identified.

13 Historical (Conti.) * In 1903 : - Sutton and Boveri proposed that
‘chromosomes’ carry the hereditary factors. Chromosomes( Chroma=color; soma=body) were recognised as thread like structures, (so called because of their affinity for certain stains). * In 1906 : - Bateson contributed the term "Genetics" for this new science. * In 1941: - Beadle and Tatum formulated the "one gene - one protein" theory. * In 1956 : - The correct number of chromosomes was established as 46.

14 Historical (Conti.) * By late 1950's :
- Excellent techniques for the study of chromosomes were developed. * In 1953: - James Watson and Francis Crick ( in Britain) described the structure of the genetic material i.e. DNA, and were awarded Nobel prize in 1962. * Mid 1970's : -The field of Medical Genetics has been transformed and significant new discoveries about the genes, their expression and genetic diseases have been made.

15 Historical (Conti.) * The 'Human Genome Project‘:
- An International project, to map the entire human genome, was initiated in 1990 to be completed by the year 2005( however, it was completed in 2003). * To-date: - extensive information has been gained about chromosomes, gene mapping, gene sequencing, functions and genetic disorders.

16 The genetic knowledge is increasing exponentially and has extensive
applications in clinical medicine

17 * During the last three decades:
- a decrease in frequency of infectious diseases. - improved nutrition, antibiotics and immunization. - almost one third of the patients in paediatric suffer from genetic defects.

18 It has become essential for all medical
personnel's to have a clear knowledge of human and medical genetics.

19 Mendels Laws of Inheritance
Three Laws of Inheritance: The Law of Unit Inheritance. The Law of Segregation. iii) The Law of Independent Assortment.

20 The Law of Unit Inheritance
The characteristics (traits i.e. genes) do not blend ( mix), but are inherited as units, which might not be expressed in the first generation off-springs, but may appear unaltered in later generations. First Generation Second Generation TT t t Tt Tt Tt Tt Tt Tt TT Tt Tt tt All tall in the first generation 75% Tall and 25% short in 2nd (As t is recessive & does not appear) generation. ( T= Tall, dominant gene; t = Short, recessive gene)

21 The Law of Segregation - The two members of a single trait (gene)
i.e. alleles, are never found in the same gamete, but always segregate and pass to different gametes Gamete Zygote - The failure of two alleles to segregate due to chromosome Gamete non-disjunction give rise to genetic defects(e.g. in Down’s syndrome)

22 The Law of Independent Assortment
* Members of different gene pairs assort to the gametes independently of one another i.e. random recombination of maternal and paternal chromosomes occur in gametes. Maternal Paternal Crossing-over Gametes

23 The exceptions to Law of Independent Assortment
(not recognised by Mendel) are closely "linked“ genes on the same chromosome, which do not assort independently. Maternal Paternal Crossing-over Gametes

24 The Genetic Material

25 What is the Genetic Material?
Proteins ? RNA? DNA?

26 Griffith’s Experiment
In live animal ( Smooth &Virulent)- due to polysaccharide capsule (Non-Virulent) (Non-Virulent) Due to absence of polysaccharide capsule Transformation Of rough to smooth form (Non-Virulent) (Virulent) (Non-Virulent) What is the Transforming Factor?

27 Griffith’s Experiment
Conducted in 1928 On a bacteria that produces pneumonia: - R(Rough) strains were non-virulent(did not produce disease) - S(Smooth) strains were virulent (produced disease) - Heated R and S strains were both non-virulent _The experiment: R injected in rats No disease Heated R injected in rats No disease S injected in rats Disease (Rat Died) Heated S injected in rats No disease Heated S + live R injected in rats Disease (Rat Died) Some substance in heated S transformed the R to S What was the Transforming Principle?

28 In culture Growth of S colonies
Experiment of Avery, Macleod and McCarty (1944) In culture (Culture) Smooth colonies No colonies Growth of S colonies What is the Transforming Factor?

29 The Transforming Principle
Experiment of Avery, Macleod and McCarty (1944) 1. Took extract from virulent(S) cells + R cells S Colonies As the bacteria was destroyed, but DNA was not. 2. Treated the extract with: (a) Proteases Mixed with R cells S Colonies (b) Ribonuclease----Mixed with R cells S Colonies DNase Mixed with R cells No Colonies of S Concluded that the transforming principle in the extract was DNA

30 (Mixing)

31 These and many other experiments proved
that DNA is the carrier of genetic information in all living organisms except RNA viruses which have RNA as the carrier of genetic

32 Genetic Material in the Living Cells
* All living organisms are made up of cells. * Cells contain a nucleus surrounded by a nuclear membrane in eukaryotic cells, and a nuclear region in the prokaryotic cells. * Chromatin is made up of DNA and proteins (mainly histones(basic) and non-histone (acidic) proteins.

33 Genetic material…contd
The study of chromosomes, their structure and their inheritance is known as Cytogenetics. Each species has a characteristic number of chromosomes and this is known as karyotype. Prior to 1950's it was believed that humans had 48 chromosomes but in 1956 it was confirmed that each human cell has 46 chromosomes (Tjio and Levan, 1956). The genes are situated on the chromosomes in a linear order. Each gene has a precise position or locus.

34 Chromosomes (Metaphase) Chromatin

35 Chromosomes * One member of each chromosome pair is derived from each parent. * Somatic cells have diploid complement of chromosomes i.e. 46. * Germ cells (Gametes: sperm and ova) have haploid complement i.e 23. * The chromosomes of dividing cells are most readily analyzed at the `metaphase' or prometaphase stage of mitosis .

36 The Normal Human Chromosomes
* Normal human cells contain 23 pairs of homologous chromosomes: - 22 pairs of autosomes (numbered as 1-22 in decreasing order of size) - 1 pair of sex chromosomes. * Autosomes are the same in males and females * Sex chromosomes are: - XX in females - XY in males. * Both X are homologous. Y is much smaller than X and has only a few genes. p q

37 Chromosome Structure * At the metaphase stage each chromosome consists of two chromatids joined at the centromere or primary constriction The centromere divides chromosomes into short (p i.e. petit) and long (q e.g. g=grand) arms. The tip of each chromosome is called telomere. The exact function of the centromere is not clear, but it is known to be responsible for the movement of the chromosomes at cell division. Telomere p Centromere q

38 Chromosomes … contd In a non-dividing cell the nucleus is filled with a thread-like material known as "chromatin". Before cell division, the chromatin multiplies (replicates), loses the relatively homogenous appearances and condenses to form rod like structures . "Genes" , are units of genetic information present on the DNA. Mitosis G2 G1 Go S The Cell Cycle

39 Each species has a characteristic gene map i. e
Each species has a characteristic gene map i.e. the chromosomal location of the genes, and it is the same in all normal individuals of each species

40 Classification Of Chromosomes
Chromosomes are classified (analysed) accordig to: 1. Shape and 2. Staining 1. Morphologically (shape) According to the position of the centromere as: (i) metacentric, (ii) sub-metacentric, (iii) acrocentric, (iv) telocentric (with centromere at one end. This occurs in other species, but not in man).

41 p q Sub-Metacentric Metacentric Chromosomes Chromosomes Telomeres
Centromere q

42 * Acrocentric chromosomes (13, 14, 15, 21 and
22) have a small mass of chromatin known as satellite attached to their short arm by narrow stalks (secondary constrict). * The stakes contain genes for 18S and 28S rRNA. Satellite Stalk

43 Staining Methods for cytogenetic analysis of chromosomes
There are several staining methods for cytogenetic analysis of chromosomes. Each stain produces specific banding patterns known as "Chromosome Banding" G banding, - Q banding, R banding, C banding. The pattern is specific for each chromosome, and is the characteristics utilized to identify each chromosome.

44 Staining Methods for Cytogenetic Analysis
G Banding: Treat with trypsin and then with Geimsa Stain. R Banding: Heat and then treat with Geimsa Stain. Q Banding: Treat with Quinicrine dye giving rise to Fluorescent bands. C Banding: Staining of the Centromere.

45 The G-Banding Pattern of Chromosomes

46 DNA packing in the Chromosomes

47 Composition of Nucleosomes
DNA Histones 2( H2A,H2B,H3,H4)

48 The Genetic material-Deoxyribonucleic acid (DNA)
-Double strand of polynucleotide. -Coiled around each other forming double helix. Strands are anti- Parallel. Sugar phosphate backbone is outside & bases are inside. A=T and G=C. A/T=1 andG/C=1 (Cargaff Ratio) 5’ 3’ 3’ 5’

49 Nitrogenous bases in DNA and RNA
Pyrimidines Purines

50 Detailed view of DNA Structure

51 The Central Dogma

52 in cytoplasm on ribosomes
Replication- in nucleus Transcription- in nucleus Translation- in cytoplasm on ribosomes

53 DNA Replication Replications occurs before cell division.
During S Phase of cell cycle. Entire DNA content is doubled. Replication is Semi-conservative. Requires: -DNA polymerases -dNTPs(N=A,T,C,G) -RNA primer -Mg++ -DNA ligases - Primase - Helicase - SS DNA binding proteins DNA Replication

54 Major Steps in DNA Replication
Lagging strand Leading strand,continuous

55 Transcription

56

57 Steps in transcription
Initiation Binding of RNA polymerase causes opening of the DNA strand and synthesis of the RNA Elongation RNA polymerase continues synthesis of RNA complementary to DNA till termination site

58 Steps in transcription
(contd) Elongation -contd Termination Rho factor binds to the termination site and when RNA polymerase reaches this site, termination occurs

59

60 Translation On ribosomes

61 Ribosomes- free and attached to endoplasmic reticulum

62 Codons on mRNA

63 Structure of tRNA

64 Steps in Translation i. Initiation ii. Elongation iii. Termination

65 Polysomes

66 Mitochondrial DNA In the human mitochondria the chromosomes are present as 10 circular double helices of DNA. They are self replicative. Contain: 16,596 bp, genes for 22 tRNAs and 2 types of ribosomal RNA required for mitochondrial protein synthesis. They also have genes for 13 polypeptides, involved in cellular oxidative phosphorylation. Both strands of DNA are transcribed and translated.

67 Mitochondrial DNA The genes on mitochondrial DNA have no introns.
The codon recognition pattern for several amino acids is different from the nuclear DNA. Mitochondria are transmitted in the egg from a mother to all of her children. Thus mitochondrial DNA is only maternally derived.

68 The Cell Cycle G2 S Mitosis G1 Go

69 The Cell Cycle The cell cycle consists of 2 phases:
Mitosis and Interphase. Mitosis (cell division) is the shortest phase. Interphase The period between successive mitosis. The G1, S and G2 phase constitute interphase. In a typical growing cell this lasts hours and mitosis lasts 1-2 hours. Some cells e.g. neurons and RBCs, do not divide and enter the Go phase. Other cells may enter Go but eventually return to continue through the cell cycle (Contd..)

70 The Cell Cycle (Contd..) Immediately after mitosis, the cell enters G1 (Gap 1) phase, where there is no DNA synthesis. Some cells spend a few hours others up to years in this phase. At this phase cells perform metabolic functions. S phase - the phase of DNA synthesis. Each chromosome in G1 phase double, and forms two chromatids joined together. By the end of S phase the DNA content of cells is doubled.

71 The Cell Cycle (Contd..) G2 phase - The chromatin condenses and forms chromosomes. Each chromosome consists of two identical sister chromatids. During this period the DNA synthesis is restricted, RNA and protein synthesis occur and cell enlarges, eventually doubling its total mass before next mitosis.

72 Cell Division

73 Cell Division Mitosis: Meiosis: - Occurs in Somatic cells.
Cell Division Mitosis: Meiosis: - Occurs in Somatic cells. - Division by which the body grows, differentiates and repairs. - Results in two identical daughter Diploid cells with genes identical to parent cells. - Chromosomes are first doubled, followed by cell division in which the number in each cell is halved (diploid). - Occur in cells of germ line. - Only once in generation. - Results in the formation of haploid, reproductive cell (gametes: ova and sperms). - Chromosomes duplicates followed by 2 cell divisions resulting in cells with half the number of chromosomes (haploid).

74 Mitosis At conception the human zygote consists of a single cell. This undergoes rapid cell division leading ultimately to the mature human adult body. Each adult human being has approximately 1x1014 cells in the body. In most organs and tissues e.g. bone marrow, skin etc. cells continue to divide throughout life. This process of somatic cell division during which the nucleus divides to produce two identical daughter cells is known as Mitosis.

75 Mitosis (contd..) * Each chromosomes divides into two daughter chromatids, one of which segregates into each daughter cells. - The number of chromosomes per cell remains unchanged. Mitosis lasts 1-2 hours. It occurs in five distinct stages : Prophase, prometaphase, metaphase, anaphase and telophase.

76 Phases of Mitosis: Prophase: The chromosome condenses and mitotic spindle begins to form. Two centrioles form in each cell from which microtubules radiate as the centrioles move towards opposite poles of the cell. Prometaphase: The nuclear membrane begins to disintegrate and chromosome spread around the cells. Each chromosome becomes attached at its centromere to a microtubule of the mitotic spindle by a specialised structure called Kinetochores.

77 Phases of Mitosis (Contd..):
Metaphase: The Chromosomes are maximally contracted and most easily visible. The Chromosomes become oriented along the equatorial plain and each chromosome is attached to the centriole by a microtubule forming the mature spindle. Anaphase: The centromere of each chromosome divides longitudinally and the two daughter chromatids separate to opposite poles of the cell.

78 Phases of Mitosis (Contd..):
Telophase: The chromatids separate completely and a new nuclear membrane is formed around each set of chromosomes. The cytoplasm separates (cytokinesis) to form two daughter cells.

79 Mitotic Cell Cycle:

80 Meoisis: The type of cell division by which the diploid cells of the germline give rise to haploid gamets, i.e. oocytes and sperms. The process involves two successive meiotic divisions: Meiosis I: This is the reduction division and the chromosome number is reduced from diploid to haploid. Meiosis II - follows Meiosis I without an intervening stage of DNA replication. The chromosomes disjoin, and one chromatid of each chromosome passes to each daughter cell.

81 Meoisis: Meiosis I: This stage has: Prophase I, Prometaphase I, Metaphase I, Anaphase I & Telophase I, just like mitosis. Meiosis II: has: Metaphase II and telophase II and results in formation of ova in female and sperms in males.

82 Meiotic Cell Cycle:

83 Genetic Consequence of Meiosis
- Reduction of chromosome number from diploid to haploid, the essential step in the formation of gametes. - Segregation of alleles, at either meiosis I or meiosis II, in accordance with Mendel’s First Law. - Shuffling of the genetic material by random assortment. - Additional shuffling of genetic material by crossing-over mechanism substantially increasing genetic variation.

84 Gametogenesis: Oogenesis:
There are differences in female and males gametogenesis Oogenesis: Mature ova develops from oogonia by a complex series of intermediate steps: During the first few months of embryonic life : Oogonia originate from primodial germ cells by a process involving mitotic divisions. At completion of embryogenesis at 3 months of intra-uterine life: The oogonia mature to primary oocytes which start to undergo meiosis.

85 Gametogenesis: At birth, all primary oocytes have entered dictyotene, a phase of maturation arrest at which they remain resuspended until meiosis is completed at the time of ovulation . At the time of ovulation, a single secondary oocyte is formed. Most of the cytoplasm is received by the daughter cell from the 1st meiotic division consists largely of a nucleus known as a polar body. Meiosis II then commences during which fertilization can occur. A second polar body is formed.

86 Gametogenesis: 2. Spermatogenesis:
Rapid process - average duration of days. At puberty, spermatogonia (which have already undergone 30 mitotic divisions) begin to mature into primary spermatocytes. These enter meiosis 1 and emerge as haploid secondary spermatocytes. These undergo second meiotic division to form spermatids, which change to mature spermatozoa

87 Genetic Disorders Genetic Disease Mutations in the: * Genome,
* Chromosome or * Gene Decrease or increase in the amount of genetic material Abnormal genetic maerial Increase or decrease in the amount of gene products (proteins). Decrease in the amount of one protein. Defective function of the protein. - Increased function. - Decreased or complete loss of function. Genetic Disease

88 Genetic Diseases

89 Classification of Genetic Diseases Single Gene Disorders
Acquired Somatic Genetic Diseases Chromosomal Disorders Multifactorial Disorders Mitochondrial Disorders

90 Single Gene Disorders Caused by mutation in or around a gene.
Can lead to critical errors in the genetic information. Exhibit characteristic pedigree pattern of inheritance (Mendelian Inheritance) Occur at a variable frequency in different population Over 7,000 single gene disorders have been identified. May be: - Autosomal - Sex linked

91 Chromosomal Disorders
Result from defect in the number (i.e. Numerical disorders) or structure (i.e. Structural disorders) of chromosomes. The first chromosomal disorder was Trisomy 21 (Downs syndrome) and was recognised in 1959. These disorders are quite common and affect about 1/800 liveborn infants. Account for almost half of all spontaneous first-trimester abortions. Do not follow a Pedigree pattern of inheritance.

92 Multifactorial Disorders
Result from interaction between environmental and genetic factors. Often polygenic in nature, no single error in the genetic information. Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals. Tend to cluster in families. Do not show characteristic pedigree pattern of inheritance.

93 Multifactorial Disorders
Congenital malformations Common disorders of adult life.

94 Mitochondrial Disorders
* The defective gene is present on the mitochondrial chromosomes. * Effect generally energy metabolism. * Effect those tissues more which require constant supply of energy e.g muscles. * Shows maternal inheritance: -effected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.

95 Acquired Somatic Genetic Diseases
Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell. These somatic mutations account for 1. A large proportion of malignancy and 2. possibly involved in events such as 'senescence' and the 'ageing process'.

96 Single Gene Disorders May be: - Autosomal - Sex linked:
Y- linked , holanderic, hemizygote X- linked , dominant or recessive

97 Modes of Inheritance of Single gene Disorders
Autosomal Sex Linked Recessive Dominant Y Linked X Linked Abnormal homozygous Recessive Dominant Normal homozygous Heterozygous Normal Abnormal

98 Autosomal Inheritance
- This is the inheritance of the gene present on the Autosomes. - Both sexes have equal chance of inheriting the disorder. - Two types: Autosomal dominant inheritance, if the gene is dominant. Autosomal recessive inheritance, if the gene is recessive. Abnormal homozygous Normal homozygous Heterozygous

99 Autosomal Dominant Inheritance
- Autosomal dominant inheritance, if the gene is dominant. - The trait (characteristic, disease) appears in every generation. - The trait is transmitted by an affected person to half the children. - Unaffected persons do not transmit the trait to their children. - The occurrence and transmission of the trait is not affected by sex. Normal male Normal female Disease male Disease female

100 Examples of Autosomal dominant disorders
Approximate Frequency/1000 Familial hypercholesterolemia 2 Von Willebrand disease 1 Adult polycystic kidney disease Huntington disease 0.5 Myotonic dystrophy 0.2 Acute intermittent porphyria Rare Dominant blindness 0.1 Dominant deafness

101 Acute Intermittent Porphyria
- AD. - Expressed in heterozygotes and homozygotes. - Uroporphyrinogen synthetase deficiency. - Increased urinary excretion of 5-amino levulinic acid and porphobilinogen (diagnostic ) . - Characterized by neurological symptoms that include severe abdominal pain, peripheral neuropathy and psychosis.

102 Punnet Square Mother Father Mother Father Affected Normal D d dD dd

103 Autosomal Recessive Inheritance
- The trait (characteristic, disease) is recessive. - The trait expresses itself only in homozygous state. - Unaffected persons (heterozygotes) may have affected childrens (if the other parent is heterozygote) . - The parents of the affected child maybe consanguineous. - Males and female are equally affected.

104 Punnett square showing autosomal recessive inheritance:
(1) Both Parents Heterozygous: 25% offspring affected Homozygous” Female % Trait “Heterozygous normal but carrier” 25% Normal Contd. A a AA Aa aa

105 (2) One Parent Heterozygous:
Male Female % Off springs normal but carrier “Heterozygous” 50% Normal _________________________________________________________________________ (3) If one Parent Homozygous: 100% of springs carriers. Female A a AA Aa A a Aa

106 Family tree of an Autosomal recessive disorder
Sickle cell disease (SS) A family with sickle cell disease -Phenotype Hb Electrophoresis AA AS SS

107 Examples of Autosomal Recessive Disorders
Disease Approximate Frequency/1000 Cystic fibrosis 0.5 Recessive Mental retardation Congenital deafness 0.2 Phenyketonuria 0.1 Sickle cell anaemia 0.1-5 -Thalassaemia Recessive blindness Spinal muscular atrophy Mucopolysaccharidosis

108 Cystic fibrosis - Most frequent autosomal recessive (AR) disorder (1 in 200 births in Caucasians) - Expressed only in homozygotes. - Heterozygote carriers are normal phenotypically - If both parents are heterozygote to abnormal gene than there is 1 in 4 (25%) chance of having child with cystic fibrosis (homozygous). - If one parent has cystic fibrosis (homo) while the other parent is normal, then all childrens will be carriers of the abnormal gene.

109 Sex – Linked Inheritance
- This is the inheritance of a gene present on the sex chromosomes. - The Inheritance Pattern is different from the autosomal inheritance. - Inheritance is different in the males and females. Recessive X-Linked Sex – linked inheritance Dominant Y- Linked

110 Y – Linked Inheritance - The gene is on the Y chromosomes.
- Shows Holandric inheritance. i.e. The gene is passed from fathers to sons only. - Daughters are not affected. e.g. Hairy ears in India. - Male are Hemizygous, the condition exhibits itself whether dominant or recessive. male Female - X Y* XX XY*

111 X – Linked Inheritance - The gene is present on the X - chromosome.
- The inheritance follows specific pattern. - Males have one X chromosome, and are hemizygous. - Females have 2 X chromosomes, they may be homozygous or heterozygous. - These disorders may be : recessive or dominant.

112 X – Linked Recessive Inheritance
- The incidence of the X-linked disease is higher in male than in female. - The trait is passed from an affected man through all his daughters to half their sons. - The trait is never transmitted directly from father to sons. - An affected women has affected sons and carrier daughters. (1) Normal female, affected male Ova All daughters carriers “not affected, All sons are normal X X* X*X Y XY

113 (2) Carrier female, normal male:
Ova 50% sons affected, 50% daughters carriers, Sperm (3) Homozygous female, normal male: - All daughters carriers. - All sons affected. X* X XX* XX Y X * Y XY

114 X - Linked Recessive Disorders
- Albinism (Ocular). - Angiokeratoma (Fabry’s disease). - Chronic granulomutous disease. - Ectodermal dysphasia (anhidrotic). - Fragile X syndrome. - Hemophilia A and B. - Ichthyosis (steroid sulphatase deficiency). - Lesch–Nyhan syndrome. - Menkes’s syndrome. - Mucopoly Sacchuridosis 11 (Hunter’s syndrome) - Muscular dystrophy (Duchenne and Beeker’s). - G-6-PD - Retinitis pigmentosa.

115 Lesch – Nyhan Syndrome - X – linked recessive disease.
- Due to deficiency of hypoxanthine guanine phosphoriboyl transferase - Purine salvage pathway is impaired. - Symptoms include: - Self mutilation tendency. - Mental retardation. - Cerebral palsy. - Uric aciduria. - Gout and kidney stones.

116 The Hemophilias - X – linked recessive disease.
- Expressed in males, very rare in females (homozygotes) [ 1 in 10,000 male births ]. - In this abnormality, the blood fails to clot due to abnormality of antihemophilic globulin. - Clinical features include severe arthritis.

117 X-Linked Dominant Disorders
The gene is on X Chromosome and is dominant. The trait occurs at the same frequency in both males and females. Hemizygous male and heterozygous females express the disease.

118 ** Punnett square showing X – linked dominant type of Inheritance:
(1) Affected male and normal female: OVA All daughters affected, all sons normal. Sperm (2) Affected female (heterozygous) and normal male: 50% sons and 50% daughters are affected % of either sex normal. Contd. X X* X*X Y XY X* X XX* XX Y X*Y XY

119 (3) Affected female (homozygous) and normal male:
OVA All children affected.. Sperm X* X X*X XX* Y X*Y

120 Chromosomal disorders
- These defects result from defects in the chromosomes. - Two groups: * Structural defects– defects in structure of chromosome. * Numerical defects– Increase or decrease in number of chromosomes - These defects are quite common (7 in 1000 live births). - Chromosomal defects do not obey specific pattern of inheritance. - These defects account for over half of all spontaneous abortions in first trimester.

121 Increase or decrease in the Change in the structure
Chromosomal Disorders Numerical Structural Increase or decrease in the number of chromosomes Change in the structure of chromosomes Euploidy Aneuploidy

122 Aneuploidy Euploidy Increase in the total Increase or decrease in
set of chromosomes e.g 3N or 4N Increase or decrease in one or more chromosomes. e.g 2N+1, 2N-1 -Triploidy (69 chromosomes) found in cases of spontaneous abortions -Trisomy (46+1) chromosomes (Down Syndrome) -Monosomy (46-1) chromosomes (Turner Syndrome)

123 Non-Disjunction

124 Triploidy (69, XXY)

125 Structural Abnormalities
Duplication Insertion Inversion Isochromosomes Ring Chromosomes Translocation

126

127

128

129

130 The Philadelphia Chromosome*
* Mutation found in all cases of chronic myeloid leukemia * The ABL & BCR fuse due to translocation and form an oncogene

131 Mitochondrial Disorders
* Effect generally energy metabolism. * Effect more those tissues which require constant supply of energy e.g muscles. * Shows maternal inheritance: -affected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.

132 Mitochondrial Disorders Lebers hereditary optic neuropathy

133 Mitochondrial Inheritance
Affected females transmit the disease to all their children. Affected males have normal children. Males cannot transmit the disease as the cytoplasm is inherited only from the mother, and mitochondria are present in the cytoplasm.

134 Multifactorial Disorders
Result from interaction between environmental and genetic factors. Often polygenic in nature, no single error in the genetic information. Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals. Tend to cluster in families. Do not show characteristic pedigree pattern of inheritance.

135 Multifactorial Disorders
Congenital malformations Common disorders of adult life.

136 Acquired Somatic Genetic Diseases
Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell. These somatic mutations account for a large proportion of malignancy and are possibly also involved in events such as 'senescence' and the 'ageing process'.

137 Examples of Genetic Diseases

138 Single-gene Disorders - Adenosine deaminase deficiency
- Alpha-1-antitypsin deficiency - Cystic fibrosis - Duchenne muscular dystrophy - Familial hypercholesterolemia - Fragile X-syndrome - Hemophilia A and B - G-6-PD deficiency - Phenylketonuria - Sickle cell anaemia - Thalassaemia

139 B. Examples of Numerical Chromosomal
Aberrations Karyotype Example 92, XXYY Tetraploidy 69, XXY Triploidy 47, XX+21 Trisomy 21(Down Syndrome) 47,XX+18 Trisomy 18 47, XX+13 Trisomy 13 47,XXY Klienfelter Syndrome 47,XXX Trisomy X 45, X Turners Syndrome

140 * Examples of significant genetic disorders: (Chromosomal disorder):
Defect Incidence Down Syndrome Trisomy 18 Trisomy 13 Klinefelter Syndrome XXX Syndrome XYY Syndrome Trisomy 21 47, XXY 45, X 47, XXX 47, XYY 1/800 1/25000 1/1000 (Males) 1/5000 (Females) 1/1000 (Females)

141 C. Multifactorial Disorders (i) Congenital malformation
- Cleft lip and cleft palate - Congenital heart disease - Neural tube defects (ii) Adult onset disease - Cancer (some) - Coronary artery disease - Diabetes mellitus

142 Examples of Multifactorial disorder
Incidence Cleft lip/ Cleft palate 1/250 – 1/600 Congenital heart disease 1/125 – 1/250 Neural tube defects 1/100 – 1/500 Coronary heart disease 1/15 – Variable Diabetes mellitus 1/10 – 1/20 Cancer variable

143 Mitochondrial Disorders
Lebers hereditary optic neuropathy

144 E. Acquired somatic genetic disorders
Some forms of cancer

145 Genotype-Phenotype correlations

146 - The alleles present at one locus. e.g..
Genotype - The genetic constitution (genes on the pair of homologous chromosomes). - The alleles present at one locus. e.g.. (a) TT or Tt or tt i.e genes for height. Where T is the “tall” gene and t is the gene for “short” height (b) A  A, A S, or S S Where A is for HbA and  S for HbS.

147 Phenotype The observed biochemical, physiological and morphological characteristics of an individual as determined by his/her genotype and the environment in which it is expressed. e.g. Genotype Phenotype TT or Tt Tall tt Short AA HbA (normal) Hetero A S HbAS SS HbS (SCA) ( Homo = Identical , Hetero = different) Dominant * Hetero Recessive

148 Genotype – Phenotype relationship
Genotype (i.e. genetic make up) determines phenotype (i.e. appearance etc.), though environmental factors may modify the phenotypic expression: e.g. TT (Proper nutrition) Tall TT (Poor nutrition) Stunted growth and poor development. - The Genotype determines the phenotype, but is affected by presence of Recessive or Dominant Gene, e.g (Conti..)

149 e.g: (i) As T is dominant, it is expressed in Homozygotes and Heterozygotes, but t is recessive and is expressed only in Homozygotes. TT and Tt tall tt short (ii) s is recessive, it is expressed only in Homozygotes while Heterozygotes are carriers but normal: A A HbA – Normal A S HbAS – Normal S S HbS – Abnormal “Sickle cell anemia”

150 - Genotype differ in the degree of their expression of:
Clinical severity, onset age, or both.(Variable expressivity). Expression of abnormal genotype maybe modified by: Other genetic loci, environmental factors or both Reduced Penetrance: in some heterozygous individuals with a dominant disorder, the presence of the mutation is reduced. Non-Penetrance: when a heterozygous individuals with a dominant disorder has no features of the disorder. “Pleiotropy” – multiple phenotypic effects of a single basic gene defect on multiple organs (genetic heterogeneity) e.g Tuberous sclerosis(AD) : learning disability, epilepsy, facial rash. New Mutations: A sudden appearance of a dominant disorder in the offspring with normal parents. Codominance: When two allelic traits are both expressed equally in a heterozygote e.g ABO blood groups. Pseudodominance: If a homozygous for AR mutation marries a carrier for the same mutation, their children have 1 in 2 chance of being affected (homo). This pattern is like dominant inheritance.

151          Genetic Polymorphism   

152 Genetic diversity among individuals
Mutations Genetic diversity among individuals not deleterious mutation Deleterious mutations Disease May effect phenotype Over generations, the influx of new nucleotide variations has ensured a high degree of genetic diversity and individuality.

153 Genetic Variation* Some mutations in the gene(coding sequence)
Variant protein Altered structure and Altered properties Some mutation in the gene DNA (coding sequence) Variant protein ,but not critical for the function Normal properties Some mutations in DNA (non-coding regions) No effect on proteins structure *Polymorphisms are common, particularly in non-coding regions of DNA

154 Genetic Polymorphism*
Many genetic loci are characterised by a number of relatively common alleles, thus producing many phenotypes in normal population Alleles that occur at a frequency of > 1% are said to be polymorphic variants Alleles that occur at a frequency of < 1% are said to be rare variants If there are two or more alleles(several forms of the same genes occupy the same locus) and the rarest occurs at a frequency of more than 1% then this loci will be considered polymorphic.

155 Gene polymorphism e.g. Gene for hair colour Wild type Alleles
If there are two or more alleles(several forms of the same genes occupy the same locus) and the rarest occurs at a frequency of more than 1% then this loci will be considered polymorphic.

156 Types of Polymorphisms (Defined by the method of detection)
DNA Polymorphism Protein Polymorphism Altered physical features Chromosome heteromorphisms Detected by altered DNA sequences Contd….. Restriction Fragment Length Polymorphism (RFLPs): Inherited variations in DNA sequence, Results in gain or loss of a site recognised by restriction endonuclease Variable number of tandem repeats (VNTRs): - Variations in the number of short, repeated nucleotide sequences (eg GC) between restriction sites - VNTRs are extremely polymorphic - Valuable in forensic medicine

157 Types of Polymorphisms (Defined by the method of detection) Contd…
Protein Polymorphism Altered physical features Chromosome heteromorphisms Contd….. Detected by: Electrophoresis Altered activity, Altered physical properties Enzyme variant: altered enzyme activity, electrophoretic mobility, thermostability or other physical properties e.g.G-6-PD deficiency. Antigenic variants: altered antigenic properties e.g. ABO blood groups.

158 Protein Polymorphism - Several proteins exist in two or more relatively common, genetically distinct , structurally different & functionally identical. - The causes of polymorphic forms: Mutation in or around gene - Examples : ABO Blood groups, Transferrin, Hb, 1 antitrypsin.

159 Not all variant proteins have clinical consequences

160 Types of Polymorphisms (Defined by the method of detection) Contd…
Altered physical features Chromosome heteromorphisms Detected by: Physical appearence Altered physical features e.g. polydacytyly, gagantism, dwarfs, hair on ears, baldness.

161 Types of Polymorphisms (Defined by the method of detection) Contd…
Detected by: Cytogenetic studies FISH Chromosome heteromorphisms Heritable differences in chromosomal appearances from one person to another, e.g. Variations in the size of the Y chromosome long arm. Variation in the size of the centromere . Variation in satellite size and structure. The occurrence of fragile sites.

162 Genetic diversity among individuals Chromosome heteromorphisms
Protein variations Generally, the karyotype of normal persons of the same sex are quite similar. Occasional variants are seen on staining. These are called heteromorphisms. These reflect difference in amount or type of DNA sequence at a particular location along a chromosome. Almost 25% are silent mutation with no effect on protein structure. Most mutations alter amino acid sequence but do not have phenotypic effect (e.g. ABO blood groups). Rare mutations produce severe phenotype effect or influence survival (e.g. phenylketonuria) e.g In long arm of chromosome. In chromosomes 1, 9, 16. In short arm of acrocentric chromosomes

163 Uses of Polymorphism As genetic “Markers”
- To distinguish inherited forms of a gene in a family. - Mapping gene to individual chromosomes by likage analysis. - Presymptomatic and prenatal diagnosis of genetic disease. - Evaluation of high and low – risk persons. - Paternity testing and forensic applications. - Matching of donor-recipient pairs of tissue and organ transplantation.

164 Advantages of Polymorphism
- Polymorphic forms are produced as result of mutation in the genetic loci. - The advantages are possibly: - Production of more stable forms. - Production of such forms that give resistance against disease: e.g. Hb S Trait are resistance to malarial plasmodia. - Natural selection for survival of the fittest.

165 Area of Significance of Polymorphism
- Blood transfusion. - Tissue typing. - Organ Transplantation. - Treatment of Haemolytic disease of new born.

166 ABO System - First identified by Landsteiner in 1900. - Human blood can be assigned to one of four types according to presence of two antigens, A and B, on the surface of Red Blood Cell and the presence of two corresponding antibodies, Anti A and Anti B in the plasma. * RBC Antigen Polymorphism: - Useful marker for: - Family and population studies. - Linkage analysis. - Different frequencies in different population. Contd.

167 * Blood Group Substances:
- Blood group substances are encoded by allelic genes A and B. - Blood group substances exhibit polymorphism. Polymorphic System Chromosomal Location Common Alleles ABO MNSs Xg 9 q34 4q28 – 31 Xp 22.3 A, B and O M and N;S and s Xga and Xg.

168 ABO Blood groups and Reaction with Antibodies
Geno Type Anti A Anti B Cellular Antigen Serum Anti Frequencies O A B AB O/O A/A, O/A B/B, O/B A/B - + NO A + B Anti A+B Neither 45% 42% 10% 4%

169 Clinical Importance of Polymorphism
Some disease genes occur with polymorphic frequencies Genetic polymorphisms may produce disease Some polymorphisms determine antigenic differences e.g. - HbS in African, Saudi Arabia - Thalassaemia in Mediterranean region Saudi Arabia - Cystic fibrosis in Europeans e.g. On exposure to drugs or environmental factor G-6-PD deficiency Malignant hyperthermia. e.g. Blood group HLA antigen for tissue typing.

170 Clinical Importance of Polymorphism
Contd….. Forensic Medicine As genetic markers e.g. DNA fingerprint of each individual differs due to polymorphic sites in many non-coding sequences e.g. Predisposing to a disease within families or populations

171 Genetic Linkage The occurrence of two or more genetic loci in such close physical proximity on a chromosome that they are more likely to assort (linked) together Crossing over does not take place between closely situated loci – So they are said to be linked C c C c No Crossing During meiosis A a b b B B b B Linked Not linked

172 Concept of Genetic Linkage
Linkage refers to loci, not to alleles (which occupy different chromosomes Measurement of genetic linkage can only take place in family studies Statistical method of measuring linkage is by calculation of lod score Contd…. Closeness of a genetic linkage is expressed in Cente Morgans (cM) or percent recombination Unlinked loci are separated by a genetic distance of 50 cM at a given allele at one locus has a 50% of being transmitted with either allele at an unlinked loci. Loci separated by crossing over in 1% of gametes are 1 cM apart Loci close to each other, so they never separate are linked at a genetic distance of zero cM

173 Concept of Genetic Linkage
Contd….. Lod Score Lod score is a acronym for “Logarithm of the Odds” ( Logrithm of the likelihood ratio). Lod score of +3 or greater at recombination distance of less than 50 cM between two loci is considered to be a strong evidence of linkage (1000 : 1 odds for linkage. Lod score of 2 or less is taken as a strong evidence there is no linkage (100: 1 odds against linkage).

174 Concept of Genetic Linkage
Contd….. Linkage disequilibrium Measure in populations, not in families This is the tendency for certain alleles at two linked loci to occur together more often than expected by chance. e.g. If the mutant allele at D occurs on the same chromosome as Mb more often than expected within a certain population linkage disequilibrium is said to exist. Mb D Disease locus = D Marker = M Alleles of Marker Ma and Mb. Distance=5cM

175 centi Morgan Defines the distance between two gene loci
If two loci are IcM apart, there is a 1% change of recombination between these loci as the chromosome is passed from parent to child It gives a rough unit of distance along the chromosome Different chromosomes have different sizes. Average chromosomes contain about 150 cM. There are about 3300 cM in the whole human genome. This corresponds to 3x109 bp. On average IcM is about 1 million bp (1000 kb).

176 Markers tightly linked to a disease
The marker linked to a disease gene, must be on the same region on the chromosome (within < 1 cM distance). Markers that are a long distance away on the same chromosome may not appear to be linked, because recombination between the two loci is high

177 Clinical Applications of Linkage
Linkage is clinically useful as it may permit Used in Prenatal diagnosis Carrier detection Presymptomatic diagnosis Elucidation of genetic factors in multifactorial disorders More precise determination of the genotype at an unidentified gene locus on the basis of readily identified linked markers Determination of the pattern of inheritance or specific for disease that exhibits genetic heterogeneity Gene mapping by determining the recombination distance between two genes on a chromosome

178 Gene Mapping This is the assignment of genes to specific chromosomal locations. Mapping is done by: Family studies to demonstrate linkage between loci Somatic cell genetic method to show that two loci are not linked (demonstrate synteny) or that an unmapped loci resides on a chromosome Gene dosage studies Cytogenetic techniques e.g. in situ hybridization Indirect means of identifying location of a gene

179 Importance of Gene Mapping
To develop optimal strategy for gene therapy by improved knowledge of genomic organization The gene map is the anantomy of the human genome Analysis of heterogeneity and segregation of human genetic diseases Provides information about linkage

180 Haemoglobinopathies and Thalassaemias

181 Haemoglobinopathies and Thalassaemias
Genetic Disorders of Haemoglobin

182 Haemoglobin - A conjugated protein consisting of iron-containing heme and protein (globin). - Globin chains are of different types: -chains and non  -chains - Each molecule is a tetramer of two - and non  - chains. - Each globin binds a haem in a haem binding site. Haemoglobin binds and transports oxygen from lungs to the tissues, while it transports CO2 from tissues to the lungs.

183 Types of Hemoglobin in adults
Globin genes Gene product Tetramers Name of Conc. in Chromosome (globin) in RBCs haemoglobin adult 11   , -chain 2 2 Hb A  , -chain 2 2 Hb A    ,-chain 2 2 Hb F <1.0 Emberyonic Hb:    , -chain 2 2 Hb-Gower II 0   ,  -chain  2 2 Hb-Gower I 0   , -chain 2 2 Hb-Portland 0

184 Structure of each Globin gene
Chromosome 11 G A  5’ 3’ Chromosome 16  2 1 2 1 5’ 3’ Structure of each Globin gene 5’ 3’ Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

185 Disorders of Haemoglobin
Thalassaemias (Biosynthetic disorder of Hb) Co-existing structural / biosynthetic disorders Haemoglobinopathies (Structural disorder of Hb) Constitute a major health problem in several populations of the world (particularly those residing in malaria endemic region)

186 Haemoglobinopathies Genetic structural disorder.
Due to mutation in the globin gene of haemoglobin. Mostly autosomal recessive inheritance. Result in haemoglobin variants with altered structure and function. Altered functions include: Reduced solubility Reduced stability Altered oxygen affinity- increased or decreased Methaemoglobin formation

187 *Types of Mutations in Haemoglobin
Point mutation: a change of a single nucleotide base in a DNA giving rise to altered amino acids in the polypeptide chains (e.g. Hb S , Hb Riyadh, Hb C) Deletions and additions: Addition and deletion of one or more bases in the globin genes (e.g. Hb-constant spring which is associated with mild -thalassaemia). Unequal crossing over: as in Hb-lepore and Hb-antilepore associated with -thalassaemias. ________________________________________________________ *Most abnormal Hbs are produced by mutations in the structural genes which determine the amino acid sequence of the globin chains of the Hb molecule.

188 Geographical distribution of common Hb variants
Variant Occurrence predominantly in: Hb S (6GluVal) Africa, Arabia, Black Americans Hb C (6Glulys) West Africa, China Hb E (26Glulys) South East Asia Hb D (121GluGln) Asia Hb O (121GluVal) Turkey and Bulgury

189 Other examples of Haemoglobin variants
His Lys Tyr His CAC AAG UAU CAC Normal Shorter chain His Lys Mutation CAC AAG UAA 3’ 3’

190 Longer chains, e.g. (Lys) (Glu) A G  2 gene AUG UAA UAA C C (Gln) (Ser)  globin Gln Lys Glu Ser 142

191 Sickle Cell Haemoglobin
GAG GTG 6 Sickle Cell RBC Haemolysis

192 Inheritance of Sickle Cell Anaemia
AR AS AS SS AS AA AS

193 Lungs pO2 Red cell sickling Tissues pO2

194 Major abnormalities & problems in SCA
Sickling of the red cell during deoxygenation, as the HbS has low solubility at low O2 partial pressure and precipitates. Chronic haemolytic anaemia due to repeated sickling in tissues and unsickling in the lungs. Plugging of microcapillaries by rigid sickled cells leading to sickle cell crises i.e severe pain and edema. This causes significant damage to internal organs, such as heart, kidney, lungs and endocrine glands. Repeated infections. Frequent cerebrovascular accidents. Hand-foot syndrome (in small,i.e.around age of 3y) Bone deformation – bossing of the forehead. Hepato-spleenomegaly. Growth retardation. Frequent blood transfusion requirements. Psychosocial problems.

195 Thalassaemias Genetic disorders resulting from
decreased biosynthesis of globin chains of haemoglobin.

196 Thalassaemias A group( not single identity) of Genetic defects.
Due to mutations in and around the globin genes. Decreased production of one or more of the globin chains. Result in an imbalance in the relative amounts of the - and non  -chains. Altered /non-  ratio. A few rare Hb variants are effectively synthesized but are highly unstable, and thus cause thalassaemias as the : chain ratio is altered. As a consequences of thalassaemias there is excess production of the other chains, and a decreased over all haemoglobin synthesis.

197 Types of Thalassaemias
* Most common - Thalassaemia

198 - Thalassaemia Hb - Decreased / ratio   In - Thalassaemia
production of - chains Normal =  - Thalassaemia Accumulation of 

199 Point Mutation producing - Thalassaemia
Less Frequent Introns Chromosome 16 5’ exon1 exon2 exon3 3’ Base Substitution 2bp del Chain Termination Defect 5bp del Poly A signal Mutation

200 Mutations Producing - Thalassaemia
Deletions Most frequent: Chromosome 16 / -/ -/- --/ --/- --/-- Normal -thal 2 hetero -thal 2 homo -thal 1 hetero HbH Disease Hydrops fetalis

201 -thalassaemia -2 One  -gene deletion.
-chain production is only about 75% of normal. May be homo- (- /- ) or heterozygous (- / ) The patient usually shows a normal phenotypic appearance but there might be mild thalassaemia symptoms. Hypochromic-microcytic RBC’s due to partial reduction of -chain.

202 -thalassaemia- 1 Two  -genes deletion- (o )thal.
The patient synthesizes -chain but it is decreased to about 50% of normal. Anaemic symptoms- hypochromic microcytic anaemia. May be homozygous (- -/- -) or heterozygous(--/ ). If the patient is homozygous than there is no -chain synthesis, and if heterozygous then there is decreased synthesis of the -chain to half normal level.

203 Hb H Disease Three -gene deletion.
The Hb present during foetal life is “Hb Bart’s” (4), while during adulthood the Hb present is “Hb H” (4). Some of the symptoms include: hepatosplenomegally, impairment of erythropoisis, and hypochromoc-microcytic haemolytic anaemia.

204 Hydrops foetalis Homozygous o-thalassaemia.
There is a complete absence of -chain (all -genes are deleted). The Hb produced at birth is Hb Barts (4). Hydrops foetalis is lethal and the baby is born dead. Symptoms include: Hepatosplenomegaly, severe hypochromic- microcytic anaemia.

205 Hb - Thalassaemia     - Thalassaemia Increased / ratio
In - Thalassaemia Decreased production of - chains Normal =  - Thalassaemia Accumulation of 

206 -Thalassaemia It is characterized by either no -chain synthesis (i.e. o) or decreased synthesis of -chain (+). Excess -chains precipitate in RBC’s causing severe ineffective erythropoiesis and haemolysis. The greater the -chains, the more severe the anaemia. Production of -chains helps to remove excess -chains and to improve the -thalassaemia. Often HbF level is increased. Majority of -thalassaemia is due to point mutation.

207 o-Thalassaemia The -chain is totally absent.
There is increase in HbF with absence of HbA. This is combined with ineffective erythropoisis. In majority of the cases, -gene is present but there is complete absence of mRNA. Characteristics of this disorder are: Skeletal deformities (e.g. enlargement of upper jaw, bossing of skull and tendency of bone fractures). Severe hypochromic- microcytic anaemia. Survival depends on regular blood transfusion. This leads to iron overload (iron accumulates in the blood and tissues, causing tissue damage). Death usually occurs in the 2nd decade of life (i.e. at age of about 20 years) if measures are not taken to avoid iron overload by chelation therapy.

208 +-Thalassaemia There is a variable amount of -chain production.
There is decreased HbA level, and increased Hb A2, level with normal or increased Hb F level (and there is an increased number of -chains in the free form). The -chain is present but there is decreased numbers of mRNA or there is an abnormality in the mRNA.

209 Mutations affecting the -Globin gene.
Chromosome 11 Mutations affecting transcription initiation Mutations affecting RNA splicing Mutations affecting translation initiation Non-sense Mutations. Mutations of polyadenylation site. >200 -Thal mutations reported to-date Worldwide

210 Clinical Classification of Thalassaemias
Thalassaemia major: The patient depends on blood transfusions especially if he is homozygous. Thalassaemia intermediate: Homozygous mild +-thalassaemia. Co-inheritance of -thalassaemia. Heterozygous -thalassaemia. Co-inheritance of additional -globin genes.  -thalassaemia and hereditary persistence of foetal Hb Homozygous Hb lepore Hb H disease. 3. Thalassaemia minor (trait): o-thalassaemia trait. +-thalassaemia trait. Hereditary persistence of foetal Hb only. -thalassaemia trait. o- and +-thalassaemia trait.

211 Hb-Lepore This is an abnormal Hb due to unequal crossing-over of the - and -genes to produce a polypeptide chain consisting of the - chain at its amino end and - chain at its carboxyl end. The -fusion(hybrid) chain is synthesized inefficiently and normal  and -chain production is abolished. The homozygotes show thalassaemia intermediate and heterozygotes show thalassaemia trait. Unequal crossing-over can be explained as crossing over between similar DNA sequence that are misaligned resulting in sequences with deletions or duplications of DNA segments; a cause of a number of genetic variants. The adjacent  and -genes differ at only 10 of their 146 a.a. residues, if mispairing occurs followed by intergenic crossing over, two hybrid genes result: one with a deletion of part of each locus (lepore gene) and one with a corresponding duplication (anti-lepore gene).

212 High Persistence of Foetal Hb (HPFH)
A group of disorders due to deletions or cross over abnormalities which affect the production of  and  chains in non-deletion forms to point mutations upstream from the -globin genes.

213 Double heterozygous indicates the presence of combinations of the following:
Hb S + O-thalassaemia. Hb S + --thalasaemia. Hb S + -thalasaemia. Hb S + HbC disease Hb S + HbE disease

214 Diagnosis of Genetic Diseases

215 Diagnosis of Genetic Diseases
Family History* Estimation of Haematological parameters Chromosomal Analysis Determination of Enzyme Activity or Specific Protein Recombinant DNA Technology Clinical Presentation* Estimation of Biochemical Parameters * Important for all genetic diseases

216 1. Family History Consanguinity of parents.
Presence of other siblings with the same disorder. Occurrence of the disorder in other members of the family. Repeated abortions or still births, mother and fathers ages. Drawing punnet square helps to determine the mode of inheritance of the genetic disorders. Autosomal or X-linked Dominant or recessive

217 2. Clinical Presentation
Certain clinical features are specific for a disease: Chronic anaemia: Haemoglobinopathies Thalassaemia Other genetic anaemias Acute anaemia, under certain stressful conditions. G-6-PD deficiency Hypoxia – sickle cell disease. Dependence on blood transfusion - -thalassaemia (major) Severe immune deficiency – ADA deficiency. Emphysema - 1 anti-trypsin deficiency. Hypercholesterolaemia – familial hypercholesterolaemia. Delayed blood coagulation – Haemophilia (decrease in factor VIII or IX). Mental retardation – Fragile syndrome (in X chromosome) or phenylketonuria (PKU). Muscular weakness and degeneration – Duchenne muscular dystrophy.

218 Recombinant DNA Technology ( Genetic Engineering)

219 Recombinant DNA Technology ( Genetic Engineering)
Techniques for cutting and joining DNA

220 Requirements for DNA technology Restriction endonucleases
Primers Vectors NTPs Probes DNA Other enzymes e.g ligases, Taq polymerases Special chemicals and equipment

221 Restriction Endonuclease
Endonucleases. Synthesized by procaryotes. Do not restrict host DNA. Recognize and cut specific base sequence of 4-6 bases in double helical DNA. The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same. 5’-GAATTC-3’ 3’-CTTAAG-5’

222 Restriction Endonuclease
Produce either Blunt Ends or Staggered ends: 5’-GAATTC-3’ 3’-CTTAAG-5’ 5’-GAA TTC-3’ 3’-CTT AAG-5’ Blunt Ends or 5’-GAATTC-3’ 3’-CTTAAG-5’ 5’-G AATTC-3’ 3’-CTTAA G-5’ Staggered Ends

223 Uses of Restriction Endonuclease
Obtaining DNA fragments of interest. Gene mapping. Sequencing of DNA fragments. DNA finger printing Recombinant DNA technology Study of gene polymorphism. Diagnosis of disease. Prenatal diagnosis

224 Sources of DNA cDNA Genomic DNA Synthesised from Synthesis of DNA
mRNA using reverse transcriptase Synthesis of DNA DNA extracted from cells Using DNA synthesiser

225 cDNA Synthesis dNTP Poly A tail AAAAAAAAA mRNA
Viral reverse transcriptase AAAAAA TTTT Hair pin loop NaOH( Hydrolysis of RNA) dNTP DNA polymerase DNA nuclease (single-strand specific) Double strand cDNA

226 Vectors Cloning vesicles DNA molecules.
Can replicate in a host e.g bacterial cells or yeast. Can be isolated and re-injected in cells. Presence can be detected. Can be introduced into bacterial cells e.g. E. coli. May carry antibiotic resistance genes.

227 Types of vectors Type Insert size
Plasmid : circular, double stranded cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli. Bacteriophage lambda: a bacterial virus infects bacteria. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid. Yeast Artificial Chromosomes (YAC) Insert size <5-10 kb. Upto 20kb. Upto 50kb. ~ kb.

228

229 Probes Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to DNA of interest. DNA or RNA. cDNA. Labeling of probes: 3H Radioactive 32P

230 Hybridization

231 Recombinant DNA Technology
Amplification of DNA Study of DNA structure and functions Others Polymerase chain reaction DNA cloning ARMS DNA sequencing DGGE RT PCR Dot blot analysis

232 Principles of Molecular Cloning
Involves: Isolation of DNA sequence of interest. Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria. Growing of the bacteria under appropriate condition. Obtaining the pure form of DNA in large quantities for molecular analysis.

233

234 Polymerase Chain Reaction (PCR)
Method to amplify a target sequence of DNA or RNA several million folds. Developed by Saiki et al in 1985. Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers. DNA 5’ ATCAGGAATTCATGCCAAGGTTGATCGATGATCGATCGATCGATTGAT 3’ 3’AGCTAGCTAGCT 5’ Primer

235

236 Application of PCR Diagnosis of genetic disease by amplification of the gene of interest, followed by detection of mutation. Detection of infectious agent e.g. bacteria and viruses. DNA sequencing. In forensic medicine.

237 Application of Recombinant
DNA Technology 1. Clinical Chemistry: Diagnosis of disease e.g. sickle cell anaemia by Mst II. Prenatal diagnosis, Premarital “ Presymptomatic “ Neonatal screening

238 Southern Blotting

239 Pathogenesis of -Thalassaemia
Withdraw blood 12.5Kb 7.0Kb 14.5Kb Extract DNA BglII 2 1 BglII BglII BamHI BamHI Treat with BglII L R Electrophoresis Southern Blotting Visualize

240

241 Cytology, Histology and Pathology Synthesis of protein in bacterial
2. Human Genetics Mutations in genes causing hereditary disease e.g. diagnosis of fibrosis Channes disease. Forensic Medicine Analysis of stains of blood, semin. Virology Detection of viral diseases e.g. hepatitis Microbiology Using specific gene probes for detection of E.coli Cytology, Histology and Pathology Used in detection of tumor. Synthesis of protein in bacterial Insulin GH Somatostatin Interferon Transgenic animal production

242

243

244 Genetic Counselling

245 Genetic Counselling for Mendelian Disorders
Genetic disorders: Chromosomal Single gene Multifactorial Mitochondrial Acquired somatic Only single disorders follow a clearly defined pedigree pattern of inheritance “Mendelian Pattern”. During genetic counselling it is essential to establish whether or not the disorder is Mendelian and to calcualte the precise risk of recurrence.

246 Essential Components of
Genetic Counselling Recurrence Risk History and pedigree construction Follow-up Confirmatory diagnosis Clinical Examination Counseling Calculation of recurrence risk - History findings - Clinical examination findings - Radiology findings - Laboratory parameter results - DNA studies results - Others Available options 5

247 ETHICAL PRINCIPLES Beneficence Fidelity Veracity Autonomy Justice
Non-Maleficence

248 Arabic/Islamic Communities
Unique features Combined family Living style Strong Religious believes Possibility of polygamy Strong link to traditions and customs Large family size Religious And cultural cohesion High rate of Consanguinous marriages Special views on Reproductive issues Artificial insemination Family planning In-vitro fertilization Abortion Adoption Fetal rights

249

250 Establishment of Mendelian Inheritance
Pattern of transmission judged from family tree. For several diseases the family tree may be conclusive even if accurate diagnosis is not made. For some diseases pedigree pattern is not helpful and only clinical diagnosis is used For some disorders the pattern looks complicated and the exact diagnosis cannot be made. More common by combination of clinical diagnosis and comparable pedigree pattern.

251

252

253 Complexities in AD Disorders
Late or variable onset of the disease. How old will the family members be, to be certain of not developing the disease, e.g. Huntington’s disease, adult onset polycystic kidney disease, myotonic dystrophy. For some conditions life tables have been prepared. 2. Lack of penetrance Penetrance: - Is the index of the proportion of individuals with the affected gene who present the disease. - Some disorders show lack of penetrance I.e. biochemical defect is present, but clinical features are absent, e.g. Huntington disease – Penetrance decreases with age. Retinoblastoma: Lack of penetrance unrelated to age.

254 Complexities in AD Disorders
Variation in Expression: Several AD disorders show variation in clinical expression and hence the disorders cannot be ruled out unless careful examination is carried out. Mild Moderate Severe expression *Problems in G.C. since those who reproduce are least severely affected, but may have severely affected children e.g. Tuberousclerosis, Myotonic dystrophy, Huntingtons disease. *Disease severity may depend on sex of the transmitting parent. “Anticipation: refers to the state that a genetic disease worsens with successive generation.

255 Factors underlying variability in AD disorders
Factors Effect Genomic imprinting Phenotype varies accordingly Anticipation due to unstable More severe phenotype in DNA successive generation Mosaicism Mild or non-penetran phenotype Modifying alleles Influence of unaffected parent Somatic mutations also Variable penetrance required for presentation (e.g. familial cancers) New mutations Sudden appearance of (AD) disorder in normal parent

256 II. Complexities in AR Disorders
Difficult to confirm as homozygote born to phenotypically normal (carrier) parents, who may not have an affected relative. Horizontal transmission ( sudden appearance of a disorder in a generation) Diagnosis makes the mode of inheritance certain. Low Risk Very low

257 Problems with AR disorders
Genetic heterogeneity. Lack of penetrance and variation in expression are much less.

258 If consanguinity present the risk is increased:
Rare disorder increase in the number of effected children due to consanguinity (c) Extensive consanguinity Appear like AD inheritance (pseudo AD)

259 Population Risk Can be calculated from: Hardy Weinberg Equilibrium
p + q = 1 [p2 + q2 = 2pq = 1] q2 = Abnormal homozygote p2 = Normal 2pq = Heterozygote e.g. 2 patients of PKU in screened. q2 = 2; q = = p = 1 – q = 0.986 (hetero)2pq =

260 Disease Gene Carrier Risk for Risk for
Risk of transmitting an AR disorder in relation to disease incidences (the spouse is healthy) Disease Gene Carrier Risk for Risk for frequency frequency frequency offspring offspring (q2)/10000 (q) (%) =2pq(%) homo. (%) healthy (affected sib) sib

261 X-Linked Disorders Occupy a prominent place in genetic counselling.
>100 X-linked disorders recognised. Majority XR; some dominant (often lethal in hemizygous male). X-chromosomes inactivation (lyonns phenomenon). applies to almost all human X-chromosomes.

262 Recognition of X-Linkage
No male-to-male transmission. Affected male  All daughters carriers (XR).  All daughters affected (XD). Unaffected males never transmit disease to either sex. A definite carrier women  risk ½ sons affected. Carrier women  ½ daughters carrier (XR)  ½ daughters affected (XD). Homozygous affected women are few  affected male are much more. These guidelines will cover most genetic counseling problems.

263 Mitochondrial Inheritance
No transmission in descendents of males, affected or not. Both sexes may be affected. Females may be symptomless carriers. All daughters of an affected or carrier female are at risk of transmitting the disorders or of becoming affected. All sons may become affected, but do not transmit it to their children

264 First degree……………………………………. 1/4 Sibs (brothers & sisters)
Degree of Relationship to patients Proportion of gene shared First degree……………………………………. 1/4 Sibs (brothers & sisters) Dizygotic twins Parents Child Second degree …….. ………………………….. 1/4 Half sibs Uncles, aunts Nephew, nieces Double first cousins Third degree: ……………………………………. 1/8 First cousins Half uncles, aunts half nephew, nieces

265 Relation shared of Homo.
Gene Chance Degree of Relation shared of Homo. Monozygotic twin Dizytotic twin st 1/ /4 Sibs st 1/ /4 Uncle-nephew (aunt-niece) nd 1/ /8 Half-sibs nd 1/ /8 Double 1st cousin nd 1/ /8 First cousin rd 1/ /16

266 Consanguinity Consanguinity relevant Not relevant
Only relevant to genetic risks if it involves both parental lives not just one. Consanguinity relevant Not relevant The rarer the disorder the higher the proportion of affected individuals from consanguineous marriages. Consanguinity must be seen in the context of particular community. An apparent relationship of a particular disorder is much less certain if 30% cousin marriages, compared to non-consanguineous mating. Extensive consanguinity (AR) appears like AD.


Download ppt "Medical Genetics. Medical Genetics "Genetics" Fields: Heredity and its variation. Subfields: - "Human Genetics”: denotes the science of heredity."

Similar presentations


Ads by Google