1. Mendelian Genetics

2. Chapter 3 Contents
3.1 Mendel Used a Model Experimental Approach to Study Patterns of Inheritance
3.2 The Monohybrid Cross Reveals How One Trait Is Transmitted from Generation to Generation
3.3 Mendel's Dihybrid Cross Generated a Unique F2 Ratio
3.4 The Trihybrid Cross Demonstrates That Mendel's Principles Apply to Inheritance of Multiple Traits
3.5 Mendel's Work Was Rediscovered in the Early Twentieth Century
Continued
© 2012 Pearson Education, Inc.

3. Chapter 3 Contents
3.6 The Correlation of Mendel's Postulates with the Behavior of Chromosomes Provided the Foundation of Modern Transmission Genetics
3.7 Independent Assortment Leads to Extensive Genetic Variation
3.8 Laws of Probability Help to Explain Genetic Events
3.9 Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data
3.10 Pedigrees Reveal Patterns of Inheritance of Human Traits
© 2012 Pearson Education, Inc.

4. Who was Gregor Mendel
The founder of modern genetics was an Austrian monk named Gregor Mendel.
Mendel was in charge of the monastery garden, where he conducted research on garden peas.

5. Austria
Not Australia!!!
G’day Mate!

6. Mendel
Gregor Mendel discovered principles of genetics in experiments with garden pea plants
Mendel showed that parents pass heritable factors to offspring
What do we call heritable factors today?
Genes

7. 3.1 Mendel Used a Model Experimental Approach to Study Patterns of Inheritance
© 2012 Pearson Education, Inc.

8. Why did Mendel chose the garden pea as his model system?
Section 3.1
Mendel used a model experimental approach to study patterns of inheritance
Why did Mendel chose the garden pea as his model system?
it is easy to grow
it has true-breeding strains
it has controlled matings: self-fertilization or cross-fertilization
it grows to maturity in one season
it has observable characteristics with two distinct forms
© 2012 Pearson Education, Inc.

9. Section 3.1
Using 7 visible features, each with two contrasting traits and true-breeding strains,
Mendel kept accurate, quantitative records of his experments
© 2012 Pearson Education, Inc.

10. Figure 3.1
© 2012 Pearson Education, Inc.

11. Section 3.1 Unappreciated during his lifetime
Rediscovered in the turn of the century
Mendel's postulates were eventually accepted as the basis for Mendelian, or transmission, genetics
© 2012 Pearson Education, Inc.

12. 3.2 The Monohybrid Cross Reveals How One Trait Is Transmitted from Generation to Generation
© 2012 Pearson Education, Inc.

13. Terms to Know before moving on:
Genes: Genetic information that codes for specific traits. Genes have specific loci on a chromosome.
Diploid (2n)/haploid (n)
True-breeding: Inherit identical alleles generation after generation
Hybrid: Offspring of a cross that has inherited a pair of nonidentical alleles for a trait.
Homozygous: Identical pair of Alleles (TT or tt)
Heterozygous: Pair of different alleles for a gene (one allele to be tall (T) and one to be short (t)

14. Terms to Know before moving on:
Dominant alleles are allele that will mask any recessive allele for the same trait.
Dominant alleles are represented with a capital letter (tall = D)
Recessive alleles are represented with a lowercase letter (short = d)
Genotype refers to an individual’s particular genes.
Phenotype refers to the individual’s observable or physical traits.

15. Gene loci Dominant allele P a B P a b Recessive allele Genotype: PP aa
Gene loci
Dominant
allele P a B P a b
Recessive
allele
Figure 9.4 Matching gene loci on homologous chromosomes.
Genotype: PP aa Bb
Homozygous
for the
dominant allele
Homozygous
for the
recessive allele
Heterozygous

16. A pea plant has the genotype Tt.
Do Now
T=tall t=short
A pea plant has the genotype Tt.
Which trait is dominant? Which is recessive?
What is the individual’s phenotype?
Explain the individual’s genotype.
Could this plant be a true bred plant?
Explain what big ‘T’ and little ‘t’ are actually representing. What are they made of? Where would you find them? How are they related to one another? How did the plant get them?

17. What causes the plant to be tall
gibberellin 3-beta-hydroxylase, a biosynthetic enzyme crucial to the division and elongation of the cells in the plant's stem
3β-hydroxylase which converts GA20 to GA1
Tallness in pea plants is regulated by a gibberellin (active), GA1, which promotes stem growth.
Gibberellins had been discovered in the 1950s, but it was not until the early 1980s that the group connected it to stem height.
CU and Australian scientists clone Mendel's historic pea-plant gene By Blaine P. Friedlander Jr.

18. gibberellin 3-beta-hydroxylase - 358 AA
What is “T”?
gibberellin 3-beta-hydroxylase AA
ATGCCTGCTATGTTAACAGATGTGTTTAGAGGCCATCCCATTCACCTCCCACACTCTCAC ATACCTGACTTCACATCTCTCCGGGAGCTCCCGGATTCTTACAAGTGGACCCCTAAAGAC GATCTCCTCTTCTCCGCTGCTCCTTCTCCTCCGGCCACCGGTGAAAACATCCCTCTCATC GACCTCGACCACCCGGACGCGACTAACCAAATCGGTCATGCATGTAGAACTTGGGGTGCC TTCCAAATCTCAAACCACGGCGTGCCTTTGGGACTTCTCCAAGACATTGAGTTTCTCACC GGTAGTCTCTTCGGGCTACCTGTCCAACGCAAGCTTAAGTCTGCTCGGTCGGAGACAGGT GTGTCCGGCTACGGCGTCGCTCGTATCGCATCTTTCTTCAATAAGCAAATGTGGTCCGAA GGTTTCACCATCACTGGCTCGCCTCTCAACGATTTCCGTAAACTTTGGCCCCAACATCAC CTCAACTACTGCGATATCGTTGAAGAGTACGAGGAACATATGAAAAAGTTGGCATCGAAA TTGATGTGGTTAGCACTAAATTCACTTGGGGTCAGCGAAGAAGACATTGAATGGGCCAGT CTCAGTTCAGATTTAAACTGGGCCCAAGCTGCTCTCCAGCTAAATCACTACCCGGTTTGT CCTGAACCGGACCGAGCCATGGGTCTAGCAGCTCATACCGACTCCACCCTCCTAACCATT CTGTACCAGAACAATACCGCCGGTCTACAAGTATTTCGCGATGATCTTGGTTGGGTCACC GTGCCACCGTTTCCTGGCTCGCTCGTGGTTAACGTTGGTGACCTCTTCCACATCCTATCC AATGGATTGTTTAAAAGCGTGTTGCACCGCGCTCGGGTTAACCAAACCAGAGCCCGGTTA TCTGTAGCATTCCTTTGGGGTCCGCAATCTGATATCAAGATATCACCTGTACCGAAGCTG GTTAGTCCCGTTGAATCGCCTCTATACCAATCGGTGACATGGAAAGAGTATCTTCGAACA AAAGCAACTCACTTCAACAAAGCTCTTTCAATGATTAGAAATCACAGAGAAGAATGA

19. Amino acid sequence
MPAMLTDVFR GHPIHLPHSH IPDFTSLREL PDSYKWTPKD DLLFSAAPSP PATGENIPLI
DLDHPDATNQ IGHACRTWGA FQISNHGVPL GLLQDIEFLT GSLFGLPVQR KLKSARSETG
VSGYGVARIA SFFNKQMWSE GFTITGSPLN DFRKLWPQHH LNYCDIVEEY EEHMKKLASK
LMWLALNSLG VSEEDIEWAS LSSDLNWAQA ALQLNHYPVC PEPDRAMGLA AHTDSTLLTI
LYQNNTAGLQ VFRDDLGWVT VPPFPGSLVV NVGDLFHILS NGLFKSVLHR ARVNQTRARL
SVAFLWGPQS DIKISPVPKL VSPVESPLYQ SVTWKEYLRT KATHFNKALS MIRNHREE

20. Biosynthesis of GA1
GA20 (inactive intermediate) - gibberellin 3-beta-hydroxylase GA1 (active growth protein)

21. T vs. t, what does this really mean?
Researchers have demonstrated that in the tall pea plants used by Mendel, the tallness gene codes for an enzyme (gibberellin 3-beta-hydroxylase) that adds a hydroxyl (OH) group at a very particular location onto GA20, which is the is the immediate precursor of GA1.
In the dwarf plants there is a change of one base in the DNA sequence, which leads to a change of one amino acid in the resulting protein. In turn, this results in an enzyme that is still active in converting GA20 into GA1, but at 1/20th the rate.
Therefore, dwarf peas are less efficient at synthesizing the gibberellin responsible for promoting stem growth. The plant becomes growth deficient.

22. What is “T”?
Dwarf peas have a defective 3β-hydroxylase which converts GA20 to GA1. This conversion makes an inactive GA into an active GA. This explains why the dwarf plants are dwarf...they lack appreciable active GA.
Spraying such dwarf peas with gibberellic acid (GA3 an active GA) can result in pea plants of normal height.

24. Genes & Alleles
In genetic crosses:
Each original pair of plants is the P (parental) generation.
The offspring are called the F1, or “first filial,” generation.

25. The F1 hybrid plants all had the character of only one of the parents.
Genes & Alleles
The F1 hybrid plants all had the character of only one of the parents.
In each cross the other parent’s trait seemed to have disappeared

26. Mendel’s F1 Crosses on Pea Plants
Genes & Alleles
Mendel’s F1 Crosses on Pea Plants
When Mendel crossed plants with contrasting characters for the same trait, the resulting offspring had only one of the characters. From these experiments, Mendel concluded that some alleles are dominant and others are recessive.

27. Mendel’s F1 Crosses on Pea Plants
Genes & Alleles
Mendel’s F1 Crosses on Pea Plants
When Mendel crossed plants with contrasting characters for the same trait, the resulting offspring had only one of the characters. From these experiments, Mendel concluded that some alleles are dominant and others are recessive.

28. Genes & Alleles
Mendel's first conclusion was that biological inheritance is determined by factors that are passed from one generation to the next.
Today, scientists call the factors that determine traits genes.

29. Genes are sections of a chromosome that code for a trait.
Genes and Alleles
Genes are sections of a chromosome that code for a trait.
Most organisms have two copies of every gene and chromosome, one from each parent.

30. The different forms of a gene are called alleles.
Genes and Alleles
Each of the traits Mendel studied was controlled by one gene that occurred in two contrasting forms that produced different characters for each trait.
The different forms of a gene are called alleles.
Certain alleles can hide or dominate over other alleles.

31. Mendel's monohybrid crosses were not sex dependent
Section 3.2
Mendel's monohybrid crosses were not sex dependent
Because it did not matter if the trait came from males or females, it is called a reciprocal cross
© 2012 Pearson Education, Inc.

32. Mendel proposed three postulates of inheritance:
Section 3.2
Mendel proposed three postulates of inheritance:
Unit factors (genes) exist in pairs
In the pair of unit factors for a single characteristic in an individual, one unit factor is dominant and the other is recessive
The paired unit factors segregate (separate) independently during gamete formation
© 2012 Pearson Education, Inc.

33. Section 3.2 The parental plants are the P generation
Their hybrid offspring are the F1 generation
A cross of the F1 plants forms the F2 generation
© 2012 Pearson Education, Inc.

34. A ______________ genotype has identical alleles
Section 3.2
For each characteristic, an organism inherits two alleles, one from each parent; the alleles can be the same or different
A ______________ genotype has identical alleles
A ______________ genotype has two different alleles
homozygous
heterozygous
© 2012 Pearson Education, Inc.

35. Review of Mendel's first three postulates Unit factors in pairs
Section 3.2
Review of Mendel's first three postulates
Unit factors in pairs
Genetic characters are controlled by unit factors existing in pairs in individual organisms
Dominance/Recessiveness
In the pair of unit factors for a single characteristic in an individual, one unit factor is dominant and the other is recessive
© 2012 Pearson Education, Inc.

36. Section 3.2
Segregation
The paired unit factors segregate (separate) independently during gamete formation
© 2012 Pearson Education, Inc.

37. Modern Genetic Terminology
Genes are found in alternative versions called _____________; a genotype is the listing of alleles an individual carries for a specific gene
The ___________ is the genetic makeup of an individual
The ____________ is the physical expression of the genetic makeup
alleles
genotype
phenotype
© 2012 Pearson Education, Inc.

38. Section 3.2
A Punnett square allows the genotypes and phenotypes resulting from a cross to be visualized easily (Figure 3.3)
© 2012 Pearson Education, Inc.

39. Figure 3.3
© 2012 Pearson Education, Inc.

40. Geneticists use the testcross to determine unknown genotypes
Testcross
Mating between an unknown genotype and a homozygous recessive individual
Will show whether the unknown genotype includes a recessive allele
Used by Mendel to confirm true-breeding genotypes
Student Misconceptions and Concerns
1. Students using Punnett squares need to be reminded that the calculations are expected statistical probabilities and not absolutes. Just as we would expect that any six playing cards dealt might be half black and half red, we frequently find that this is not true. This might be a good time to show how larger sample sizes increase the likelihood that sampling will reflect expected ratios.
Teaching Tips
1. Consider challenging your students to explain why a testcross of two black Labs of unknown genotypes might not reveal the genotype of each dog. (If both dogs are heterozygous, or homozygous, the results would reveal the genotypes because the offspring would either be three dark and one brown or all dark. But if one black Lab was homozygous and the other heterozygous, we could not determine which Lab has which genotype.)

41. Two possibilities for the black dog:
Testcross:
Genotypes B_ bb
Two possibilities for the black dog: BB or Bb
Figure 9.6 Using a testcross to determine genotype.
If the black Labrador retriever has the Bb genotype, chocolate offspring are expected.
To test whether a round-seeded pea plant is true breeding, what plant would you use for the testcross? A wrinkled-seeded plant.
What result would show that the round-seeded plant was NOT true breeding? Having wrinkled-seeded plants among the offspring of the testcross.
Gametes B B b b Bb b Bb bb
Offspring
All black
1 black : 1 chocolate

42. Figure 3.4
© 2012 Pearson Education, Inc.

43. DO NOW P=purple, p=white P is dominant to p
If purple is dominant to white, show a cross between a homozygous Dominant purple flower with a white flower.
Show a cross of the F1 generation.
What is the genotypic ratio of the F2?
What is the phenotypic ratio of the F2?
What percentage of the total offspring would one expect to be purple?
What percentage of the purple flowers would one expect to be heterozygous.

44. PP P P P P pp All All p p Genetic makeup (alleles) P plants GametesPP pp
Gametes
All P
All p
F1 plants
(hybrids)
All Pp P
Gametes 1 – 2 1 – 2 p
Sperm
Figure 9.3B Explanation of the crosses in Figure 9.3A.
A Punnett square is used to show all possible fertilization events for parental gametes. In three quarters of the F2 genotypes, there will be at least one dominant allele. P p
F2 plants
Phenotypic ratio
3 purple : 1 white P PP Pp
Eggs
Genotypic ratio
1 PP : 2 Pp : 1 pp p Pp pp

45. Gametes are also known as
Review
Gametes are also known as
genes.
sex cells.
alleles.
hybrids.

46. Review
The offspring of crosses between parents with different traits are called
alleles.
hybrids.
gametes.
dominant.

47. In Mendel’s pea experiments, the male gametes are the
Review
In Mendel’s pea experiments, the male gametes are the
eggs.
seeds.
pollen.
sperm.

48. Review
In a cross of a true-breeding tall pea plant with a true-breeding short pea plant, the F1 generation consists of
all short plants.
all tall plants.
half tall plants and half short plants.
all plants of intermediate height.

49. Review
If a particular form of a trait is always present when the allele controlling it is present, then the allele must be
dominant.

50. Review
A form of a gene that is not expressed when paired with a dominant allele is called a ______________________
recessive allele

51. Review
Sections of chromosomes that code for a trait are called ______________________
genes

52. Review
Organisms usually get one copy of each gene from each parent. The different forms of the same gene are called ______________________
alleles

53. 3.3 Mendel's Dihybrid Cross Generated a Unique F2 Ratio
© 2012 Pearson Education, Inc.

54. Mendel's dihybrid cross generated a unique F2 ratio
Section 3.3
Mendel's dihybrid cross generated a unique F2 ratio
A dihybrid cross involves two pairs of contrasting traits (Figure 3.5)
© 2012 Pearson Education, Inc.

55. Figure 3.5
© 2012 Pearson Education, Inc.

56. The product law can be used to predict the frequency with which two independent events will occur simultaneously
Figure 3.6
© 2012 Pearson Education, Inc.

57. Figure 3.7
© 2012 Pearson Education, Inc.

58. Mendel's fourth postulate: Independent assortment
Section 3.3
Mendel's fourth postulate: Independent assortment
Mendel's fourth postulate states that
traits assort independently during gamete formation
all possible combinations of gametes will form with equal frequency
© 2012 Pearson Education, Inc.

59. 3.4 The Trihybrid Cross Demonstrates That Mendel's Principles Apply to Inheritance of Multiple Traits
© 2012 Pearson Education, Inc.

60. Section 3.4
The trihybrid cross demonstrates that mendel's principles apply to inheritance of multiple traits
Trihybrid crosses involving three independent traits show that Mendel's rules apply to any number of traits
© 2012 Pearson Education, Inc.

61. Section 3.4 The forked-line method, or branch diagram
The forked-line (branched diagram) method is easier to use than a Punnett square for analysis of inheritance of larger number of traits

62. Section 3.4
Figure 3.8
© 2012 Pearson Education, Inc.

63. Section 3.4
Some simple mathematical rules shown in Table 3.1 apply in working genetics problems
© 2012 Pearson Education, Inc.

64. Table 3.1
© 2012 Pearson Education, Inc.

65. 3.5 Mendel's Work Was Rediscovered in the Early Twentieth Century
© 2012 Pearson Education, Inc.

66. Section 3.5 The chromosomal theory of inheritance
The chromosomal theory of inheritance proposed that the separation of chromosomes during meiosis could be the basis for Mendel's principles of segregation and independent assortment
© 2012 Pearson Education, Inc.

67. Explaining Mendelian Genetics
Figure 3.10a
© 2012 Pearson Education, Inc.

68. Explaining Mendelian Genetics
Figure 3.10b
© 2012 Pearson Education, Inc.

69. Explaining Mendelian Genetics
Figure 3.10c
© 2012 Pearson Education, Inc.

70. Figure 3.10
© 2012 Pearson Education, Inc.

71. 3.7 Laws of Probability Help to Explain Genetic Events
© 2012 Pearson Education, Inc.

72. Laws of probability help to explain genetic events
Section 3.7
Laws of probability help to explain genetic events
A major consequence of independent assortment is the production of genetically dissimilar gametes
Genetic variation results from independent assortment and is very important to the process of evolution
© 2012 Pearson Education, Inc.

73. Section 3.7
The probability of two independent events occurring at the same time can be calculated using the product law
The probability of both events occurring is the product of the probability of each individual event
© 2012 Pearson Education, Inc.

74. What are the chance of a coin landing on heads? On tails?
Flip a coin
What are the chance of a coin landing on heads? On tails?
The chance, or probability, of either outcome is equal. Therefore, the probability that a single coin flip will land heads up is 1 chance in 2. This amounts to 1/2, or 50 percent.

75. Flip a coin
Each coin flip is an independent event, with a one chance in two probability of landing heads up.
With that in mind, if you flip a coin three times in a row, what is the probability that it will land heads up every time?
1/2 × 1/2 × 1/2 = 1/8

76. Section 3.7
The sum law is used to calculate the probability of a generalized outcome that can be accomplished in more than one way
The sum law states that the probability of obtaining any single outcome, where that outcome can be achieved in two or more events, is equal to the sum of the individual probabilities of all such events
© 2012 Pearson Education, Inc.

77. Section 3.7
When one event depends on another, the likelihood of the desired outcome is the conditional probability
© 2012 Pearson Education, Inc.

78. Section 3.7 The binomial theory
The binomial theorem can be used to calculate the probability of any specific set of outcomes among a large number of potential events
© 2012 Pearson Education, Inc.

79. 3.8 Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data
© 2012 Pearson Education, Inc.

80. Section 3.8: Chi-Square analysis evaluates the influence of chance on genetic data
Chance deviation from an expected outcome is diminished by larger sample size
© 2012 Pearson Education, Inc.

81. X2= ∑ (O-E)2 E Chi Square Analysis O = Observed E = Expected
∑ = The sum of
X2 = Chi Square Value
(O-E)2 E

82. Section 3.8: Chi-Square Calculations and Null Hypothesis
When we assume that data will fit a given ratio, we establish what is called the null hypothesis—so named because it assumes that there is no real difference between the measured values (or ratio) and the predicted values (or ratio)
The apparent difference can be attributed purely to chance
© 2012 Pearson Education, Inc.

83. Create a null hypothesis:
Try This
50% of the students population at EHTHS is male, and 50% is female. Based on this information, for a class of our size, what would the expected number of male and female students be?
Create a null hypothesis:
There is no real difference between the male to female ratio in our class compared to the general population and that any difference is due solely to chance..
© 2012 Pearson Education, Inc.

84. X2= ∑ (O-E)2 E Solve for X2 X2= (Omale-Emale)2 (Ofemale-Efemale)2
O = Observed
E = Expected
∑ = The sum of
X2 = Chi Square Value
Males O = ___
Males E = ___
Females O = ___
Females E = ___
(O-E)2 E
(Omale-Emale)2
(Ofemale-Efemale)2
X2=
Emale
Efemale
© 2012 Pearson Education, Inc.

85. Section 3.8
Chi-square (2) analysis is used to test how well the data fit the null hypothesis
Table 3.3 shows the steps in 2 calculations for the F2 generation of a monohybrid cross
© 2012 Pearson Education, Inc.

86. Table 3.3
© 2012 Pearson Education, Inc.

87. Section 3.8
Chi-square analysis requires that the degree of freedom (df) be taken into account, since more deviation is expected with a higher degree of freedom (Figure 3.11)
The degree of freedom is equal to n – 1, where n is the number of different categories into which each datum point may fall
What are we looking at and what are the possible outcomes we could observe? How many categories? What is our degree of freedom?
Male or female, 2 categories
df = n-1
df = 2-1 = 1
© 2012 Pearson Education, Inc.

88. Figure 3.11
© 2012 Pearson Education, Inc.

89. Section 3.8
Once the number of degrees of freedom is determined, the 2 value can be interpreted in terms of a corresponding probability value (p)
© 2012 Pearson Education, Inc.

90. Figure 3.11
© 2012 Pearson Education, Inc.

91. Conclusion
© 2012 Pearson Education, Inc.

92. 3.9 Pedigrees Reveal Patterns of Inheritance of Human Traits
© 2012 Pearson Education, Inc.

93. Pedigrees reveal patterns of inheritance of human traits
Section 3.9
Pedigrees reveal patterns of inheritance of human traits
A pedigree shows a family tree with respect to a given trait. Pedigree analysis reveals patterns of inheritance
© 2012 Pearson Education, Inc.

94. Figure 3.12
© 2012 Pearson Education, Inc.

95. Section 3.9 Pedigree conventions
Parents are connected by a single horizontal line, and vertical lines lead to their offspring
If the parents are related (consanguineous), such as first cousins, they are connected by a double line
Offspring are called sibs (siblings) and are connected by a horizontal sibship line

96. Section 3.9
Twins are indicated by diagonal lines stemming from a vertical line connected to the sibship line
For identical (monozygotic) twins, the diagonal lines are linked by a horizontal line
Fraternal (dizygotic) twins lack this connecting line
© 2012 Pearson Education, Inc.

97. Tell me something about I-3 or I-4
Figure 3.13
© 2012 Pearson Education, Inc.

98. Section 3.9 Pedigree analysis
Pedigree analysis of human traits has been an extremely valuable tool in human genetic studies (see Table 3.4 for some examples of human traits for which pedigree analysis is very useful)
© 2012 Pearson Education, Inc.

99. Table 3.4
© 2012 Pearson Education, Inc.

100. If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____.
all green
1/4 green and 3/4 yellow
1/2 green and 1/2 yellow
3/4 green and 1/4 yellow
all yellow
D. ¾ green and ¼ yellow.
© 2012 Pearson Education, Inc.

101. If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____.
3/4 green and 1/4 yellow
The cross is expected to produce offspring in the genotypic proportions of 1/4 GG, 2/4 Gg, and 1/4 gg. Since G is dominant to g, 1/4 GG and 2/4 Gg = 3/4 green and 1/4 gg is yellow.
© 2012 Pearson Education, Inc.

102. If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)?
Cross it to a homozygous dominant mouse.
Cross it to a mouse with the dominant trait but a similarly unknown genotype.
Cross it to a mouse with the recessive trait.
Cross it to a heterozygous dominant mouse.
It cannot be determined.
C. Cross it to a mouse with the recessive trait.
© 2012 Pearson Education, Inc.

103. If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)?
Cross it to a mouse with the recessive trait.
In order to identify an unknown genotype, one performs a testcross, which is a cross to a homozygous recessive individual. If there are many offspring, all with the dominant phenotype, the tested mouse is homozygous dominant. If some offspring have the recessive trait (half would be expected), the tested mouse is heterozygous.
© 2012 Pearson Education, Inc.

104. In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment?
1:2:1
9:3:3:1
1:1
3:1
2:1
D. 3:1
© 2012 Pearson Education, Inc.

105. In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment?
3:1
While we are looking at two genes, the "G" locus cross is GG x gg. The resultant offspring will all be Gg, and have the dominant phenotype. As a result, only the Bb x Bb cross contributes to the variation.
P BbGG X Bbgg
Gametes 1/2 BG, 1/2 bG 1/2 Bg, 1/2 bg
F1 1/4 BBGg, 1/4 BbGg, 1/4 bBGg, 1/4 bbGg
3 B-Gg
1 bbGg
© 2012 Pearson Education, Inc.

106. What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring?
1/2
1/4
1/8
1/16
1/32
D. 1/16
© 2012 Pearson Education, Inc.

107. What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring?
1/16
For each birth, the probability that the couple will have a homozygous recessive child is 1/4. Using the product law, the probability of having two such offspring is 1/4  1/4  1/16.
© 2012 Pearson Education, Inc.

108. How many different types of gametes can be formed by the genotype AaBbCc?3 4 8 16 32
C. 8
© 2012 Pearson Education, Inc.

109. How many different types of gametes can be formed by the genotype AaBbCc?8
First, you must determine the number of different heterozygous gene pairs (n) involved. Once n is determined, 2n is the number of different gametes that can be formed. Here, there are three heterozygous genes, so the correct formula is 23 = 8.
The possible gametes are
P genotype AaBbCc
Gametes ABC ABc AbC Abc aBC aBc abC abc
© 2012 Pearson Education, Inc.