Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chapter 3 Lecture Concepts of Genetics Tenth Edition Mendelian Genetics.

Similar presentations


Presentation on theme: "Chapter 3 Lecture Concepts of Genetics Tenth Edition Mendelian Genetics."— Presentation transcript:

1 Chapter 3 Lecture Concepts of Genetics Tenth Edition Mendelian Genetics

2 © 2012 Pearson Education, Inc. Chapter 3 Contents 3.1Mendel Used a Model Experimental Approach to Study Patterns of Inheritance 3.2The Monohybrid Cross Reveals How One Trait Is Transmitted from Generation to Generation 3.3Mendel's Dihybrid Cross Generated a Unique F 2 Ratio 3.4The Trihybrid Cross Demonstrates That Mendel's Principles Apply to Inheritance of Multiple Traits 3.5Mendel's Work Was Rediscovered in the Early Twentieth Century Continued

3 © 2012 Pearson Education, Inc. Chapter 3 Contents 3.6The Correlation of Mendel's Postulates with the Behavior of Chromosomes Provided the Foundation of Modern Transmission Genetics 3.7Independent Assortment Leads to Extensive Genetic Variation 3.8Laws of Probability Help to Explain Genetic Events 3.9Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data 3.10Pedigrees Reveal Patterns of Inheritance of Human Traits

4 Who was Gregor Mendel The founder of modern genetics was an Austrian monk named Gregor Mendel. Mendel was in charge of the monastery garden, where he conducted research on garden peas.

5 Austria Not Australia!!! G’day Mate!

6 Mendel garden pea plants –Gregor Mendel discovered principles of genetics in experiments with garden pea plants Mendel showed that parents pass heritable factors to offspring –What do we call heritable factors today? GenesGenes

7 © 2012 Pearson Education, Inc. 3.1 Mendel Used a Model Experimental Approach to Study Patterns of Inheritance

8 © 2012 Pearson Education, Inc. Section 3.1 Mendel used a model experimental approach to study patterns of inheritance Why did Mendel chose the garden pea as his model system? –it is easy to grow –it has true-breeding strains –it has controlled matings: self- fertilization or cross-fertilization –it grows to maturity in one season –it has observable characteristics with two distinct forms

9 © 2012 Pearson Education, Inc. Section 3.1 Using 7 visible features, each with two contrasting traits and true-breeding strains, –Mendel kept accurate, quantitative records of his experments

10 © 2012 Pearson Education, Inc. Figure 3.1

11 © 2012 Pearson Education, Inc. Section 3.1 Unappreciated during his lifetime Rediscovered in the turn of the century Mendel's postulates were eventually accepted as the basis for Mendelian, or transmission, genetics

12 © 2012 Pearson Education, Inc. 3.2 The Monohybrid Cross Reveals How One Trait Is Transmitted from Generation to Generation

13 Terms to Know before moving on: Genes: Genetic information that codes for specific traits. Genes have specific loci on a chromosome. Diploid (2n)/haploid (n) True-breeding: Inherit identical alleles generation after generation Hybrid: Offspring of a cross that has inherited a pair of nonidentical alleles for a trait. Homozygous: Identical pair of Alleles (TT or tt) Heterozygous: Pair of different alleles for a gene (one allele to be tall (T) and one to be short (t)

14 Terms to Know before moving on: Dominant alleles are allele that will mask any recessive allele for the same trait. –Dominant alleles are represented with a capital letter (tall = D) –Recessive alleles are represented with a lowercase letter (short = d) Genotype refers to an individual’s particular genes. Phenotype refers to the individual’s observable or physical traits.

15 Gene loci Homozygous for the dominant allele Dominant allele Homozygous for the recessive allele Heterozygous Recessive allele Genotype: P B a P PP a aa b Bb

16 Do Now T=tall t=short A pea plant has the genotype Tt. –Which trait is dominant? Which is recessive? –What is the individual’s phenotype? –Explain the individual’s genotype. –Could this plant be a true bred plant? –Explain what big ‘T’ and little ‘t’ are actually representing. What are they made of? Where would you find them? How are they related to one another? How did the plant get them?

17 What causes the plant to be tall gibberellin 3-beta-hydroxylase, a biosynthetic enzyme crucial to the division and elongation of the cells in the plant's stem 3β-hydroxylase which converts GA 20 to GA 1 Tallness in pea plants is regulated by a gibberellin (active), GA1, which promotes stem growth. –Gibberellins had been discovered in the 1950s, but it was not until the early 1980s that the group connected it to stem height. CU and Australian scientists clone Mendel's historic pea-plant gene By Blaine P. Friedlander Jr.

18 What is “T”? gibberellin 3-beta-hydroxylase AA ATGCCTGCTATGTTAACAGATGTGTTTAGAGGCCATCCCATTCACCTCCCACACTCTCAC ATACCTGACTTCACATCTCTCCGGGAGCTCCCGGATTCTTACAAGTGGACCCCTAAAGAC GATCTCCTCTTCTCCGCTGCTCCTTCTCCTCCGGCCACCGGTGAAAACATCCCTCTCATC GACCTCGACCACCCGGACGCGACTAACCAAATCGGTCATGCATGTAGAACTTGGGGTGCC TTCCAAATCTCAAACCACGGCGTGCCTTTGGGACTTCTCCAAGACATTGAGTTTCTCACC GGTAGTCTCTTCGGGCTACCTGTCCAACGCAAGCTTAAGTCTGCTCGGTCGGAGACAGGT GTGTCCGGCTACGGCGTCGCTCGTATCGCATCTTTCTTCAATAAGCAAATGTGGTCCGAA GGTTTCACCATCACTGGCTCGCCTCTCAACGATTTCCGTAAACTTTGGCCCCAACATCAC CTCAACTACTGCGATATCGTTGAAGAGTACGAGGAACATATGAAAAAGTTGGCATCGAAA TTGATGTGGTTAGCACTAAATTCACTTGGGGTCAGCGAAGAAGACATTGAATGGGCCAGT CTCAGTTCAGATTTAAACTGGGCCCAAGCTGCTCTCCAGCTAAATCACTACCCGGTTTGT CCTGAACCGGACCGAGCCATGGGTCTAGCAGCTCATACCGACTCCACCCTCCTAACCATT CTGTACCAGAACAATACCGCCGGTCTACAAGTATTTCGCGATGATCTTGGTTGGGTCACC GTGCCACCGTTTCCTGGCTCGCTCGTGGTTAACGTTGGTGACCTCTTCCACATCCTATCC AATGGATTGTTTAAAAGCGTGTTGCACCGCGCTCGGGTTAACCAAACCAGAGCCCGGTTA TCTGTAGCATTCCTTTGGGGTCCGCAATCTGATATCAAGATATCACCTGTACCGAAGCTG GTTAGTCCCGTTGAATCGCCTCTATACCAATCGGTGACATGGAAAGAGTATCTTCGAACA AAAGCAACTCACTTCAACAAAGCTCTTTCAATGATTAGAAATCACAGAGAAGAATGA

19 Amino acid sequence MPAMLTDVFR GHPIHLPHSH IPDFTSLREL PDSYKWTPKD DLLFSAAPSP PATGENIPLI DLDHPDATNQ IGHACRTWGA FQISNHGVPL GLLQDIEFLT GSLFGLPVQR KLKSARSETG VSGYGVARIA SFFNKQMWSE GFTITGSPLN DFRKLWPQHH LNYCDIVEEY EEHMKKLASK LMWLALNSLG VSEEDIEWAS LSSDLNWAQA ALQLNHYPVC PEPDRAMGLA AHTDSTLLTI LYQNNTAGLQ VFRDDLGWVT VPPFPGSLVV NVGDLFHILS NGLFKSVLHR ARVNQTRARL SVAFLWGPQS DIKISPVPKL VSPVESPLYQ SVTWKEYLRT KATHFNKALS MIRNHREE

20 Biosynthesis of GA1 GA20 (inactive intermediate) - gibberellin 3-beta-hydroxylase  GA1 (active growth protein)

21 T vs. t, what does this really mean? Researchers have demonstrated that in the tall pea plants used by Mendel, the tallness gene codes for an enzyme (gibberellin 3-beta-hydroxylase) that adds a hydroxyl (OH) group at a very particular location onto GA20, which is the is the immediate precursor of GA1. In the dwarf plants there is a change of one base in the DNA sequence, which leads to a change of one amino acid in the resulting protein. In turn, this results in an enzyme that is still active in converting GA20 into GA1, but at 1/20th the rate. –Therefore, dwarf peas are less efficient at synthesizing the gibberellin responsible for promoting stem growth. The plant becomes growth deficient.

22 What is “T”? Dwarf peas have a defective 3β- hydroxylase which converts GA 20 to GA 1. This conversion makes an inactive GA into an active GA. This explains why the dwarf plants are dwarf...they lack appreciable active GA. Spraying such dwarf peas with gibberellic acid (GA 3 an active GA) can result in pea plants of normal height.

23

24 Genes & Alleles In genetic crosses: Each original pair of plants is the P (parental) generation. The offspring are called the F 1, or “first filial,” generation.

25 Genes & Alleles F 1 only The F 1 hybrid plants all had the character of only one of the parents. In each cross the other parent’s trait seemed to have disappeared

26 Genes & Alleles Mendel’s F 1 Crosses on Pea Plants

27 Genes & Alleles Mendel’s F 1 Crosses on Pea Plants

28 Genes & Alleles Mendel's first conclusion was that biological inheritance is determined by factors that are passed from one generation to the next. genes Today, scientists call the factors that determine traits genes.

29 Genes and Alleles Genes are sections of a chromosome that code for a trait. Most organisms have two copies of every gene and chromosome, one from each parent.

30 Genes and Alleles Each of the traits Mendel studied was controlled by one gene that occurred in two contrasting forms that produced different characters for each trait. The different forms of a gene are called alleles. Certain alleles can hide or dominate over other alleles.

31 © 2012 Pearson Education, Inc. Section 3.2 Mendel's monohybrid crosses were not sex dependent Because it did not matter if the trait came from males or females, it is called a reciprocal cross

32 © 2012 Pearson Education, Inc. Section 3.2 Mendel proposed three postulates of inheritance: –Unit factors (genes) exist in pairs –In the pair of unit factors for a single characteristic in an individual, one unit factor is dominant and the other is recessive –The paired unit factors segregate (separate) independently during gamete formation

33 © 2012 Pearson Education, Inc. Section 3.2 The parental plants are the P generation Their hybrid offspring are the F 1 generation A cross of the F 1 plants forms the F 2 generation

34 © 2012 Pearson Education, Inc. Section 3.2 For each characteristic, an organism inherits two alleles, one from each parent; the alleles can be the same or different –A ______________ genotype has identical alleles –A ______________ genotype has two different alleles homo zygous hetero zygous

35 © 2012 Pearson Education, Inc. Section 3.2 Review of Mendel's first three postulates Unit factors in pairs –Genetic characters are controlled by unit factors existing in pairs in individual organisms Dominance/Recessiveness –In the pair of unit factors for a single characteristic in an individual, one unit factor is dominant and the other is recessive

36 © 2012 Pearson Education, Inc. Section 3.2 Segregation –The paired unit factors segregate (separate) independently during gamete formation

37 © 2012 Pearson Education, Inc. Modern Genetic Terminology Genes are found in alternative versions called _____________; a genotype is the listing of alleles an individual carries for a specific gene The ___________ is the genetic makeup of an individual The ____________ is the physical expression of the genetic makeup alleles genotype phenotype

38 © 2012 Pearson Education, Inc. Section 3.2 A Punnett square allows the genotypes and phenotypes resulting from a cross to be visualized easily (Figure 3.3)

39 © 2012 Pearson Education, Inc. Figure 3.3

40 Geneticists use the testcross to determine unknown genotypes –Testcross Mating between an unknown genotype and a homozygous recessive individual –Will show whether the unknown genotype includes a recessive allele –Used by Mendel to confirm true- breeding genotypes

41 B_ or Two possibilities for the black dog: Testcross: Genotypes Gametes Offspring1 black : 1 chocolate All black Bb bb BB Bbbb B b Bb b b B

42 © 2012 Pearson Education, Inc. Figure 3.4

43 1.If purple is dominant to white, show a cross between a homozygous Dominant purple flower with a white flower. 2.Show a cross of the F1 generation. 3.What is the genotypic ratio of the F2? 4.What is the phenotypic ratio of the F2? 5.What percentage of the total offspring would one expect to be purple? 6.What percentage of the purple flowers would one expect to be heterozygous.

44 P plants 1–21–2 1–21–2 Genotypic ratio 1 PP : 2 Pp : 1 pp Phenotypic ratio 3 purple : 1 white F 1 plants (hybrids) Gametes Genetic makeup (alleles) All All P p Sperm Eggs PP p ppPp P p P p P P p PP pp All Gametes F 2 plants

45 –Gametes are also known as genes. sex cells. alleles. hybrids. Review

46 –The offspring of crosses between parents with different traits are called alleles. hybrids. gametes. dominant. Review

47 –In Mendel’s pea experiments, the male gametes are the eggs. seeds. pollen. sperm. Review

48 –In a cross of a true-breeding tall pea plant with a true-breeding short pea plant, the F 1 generation consists of all short plants. all tall plants. half tall plants and half short plants. all plants of intermediate height. Review

49 –If a particular form of a trait is always present when the allele controlling it is present, then the allele must be dominant. Review

50 A form of a gene that is not expressed when paired with a dominant allele is called a ______________________ recessive allele

51 Review Sections of chromosomes that code for a trait are called ______________________ genes

52 Review Organisms usually get one copy of each gene from each parent. The different forms of the same gene are called ______________________ alleles

53 © 2012 Pearson Education, Inc. 3.3 Mendel's Dihybrid Cross Generated a Unique F 2 Ratio

54 © 2012 Pearson Education, Inc. Section 3.3 Mendel's dihybrid cross generated a unique F 2 ratio A dihybrid cross involves two pairs of contrasting traits (Figure 3.5)

55 © 2012 Pearson Education, Inc. Figure 3.5

56 © 2012 Pearson Education, Inc. Figure 3.6 The product law can be used to predict the frequency with which two independent events will occur simultaneously

57 © 2012 Pearson Education, Inc. Figure 3.7

58 © 2012 Pearson Education, Inc. Section 3.3 Mendel's fourth postulate: Independent assortment Mendel's fourth postulate states that –traits assort independently during gamete formation –all possible combinations of gametes will form with equal frequency

59 © 2012 Pearson Education, Inc. 3.4 The Trihybrid Cross Demonstrates That Mendel's Principles Apply to Inheritance of Multiple Traits

60 © 2012 Pearson Education, Inc. Section 3.4 The trihybrid cross demonstrates that mendel's principles apply to inheritance of multiple traits Trihybrid crosses involving three independent traits show that Mendel's rules apply to any number of traits

61 Section 3.4 The forked-line method, or branch diagram The forked-line (branched diagram) method is easier to use than a Punnett square for analysis of inheritance of larger number of traits

62 © 2012 Pearson Education, Inc. Section 3.4 Figure 3.8

63 © 2012 Pearson Education, Inc. Section 3.4 Some simple mathematical rules shown in Table 3.1 apply in working genetics problems

64 © 2012 Pearson Education, Inc. Table 3.1

65 © 2012 Pearson Education, Inc. 3.5 Mendel's Work Was Rediscovered in the Early Twentieth Century

66 © 2012 Pearson Education, Inc. Section 3.5 The chromosomal theory of inheritance The chromosomal theory of inheritance proposed that the separation of chromosomes during meiosis could be the basis for Mendel's principles of segregation and independent assortment

67 © 2012 Pearson Education, Inc. Explaining Mendelian Genetics Figure 3.10a

68 © 2012 Pearson Education, Inc. Explaining Mendelian Genetics Figure 3.10b

69 © 2012 Pearson Education, Inc. Explaining Mendelian Genetics Figure 3.10c

70 © 2012 Pearson Education, Inc. Figure 3.10

71 © 2012 Pearson Education, Inc. 3.7 Laws of Probability Help to Explain Genetic Events

72 © 2012 Pearson Education, Inc. Section 3.7 Laws of probability help to explain genetic events A major consequence of independent assortment is the production of genetically dissimilar gametes Genetic variation results from independent assortment and is very important to the process of evolution

73 © 2012 Pearson Education, Inc. Section 3.7 The probability of two independent events occurring at the same time can be calculated using the product law The probability of both events occurring is the product of the probability of each individual event

74 Flip a coin What are the chance of a coin landing on heads? On tails? The chance, or probability, of either outcome is equal. Therefore, the probability that a single coin flip will land heads up is 1 chance in 2. This amounts to 1/2, or 50 percent.

75 Flip a coin –Each coin flip is an independent event, with a one chance in two probability of landing heads up. –With that in mind, if you flip a coin three times in a row, what is the probability that it will land heads up every time? 1/2 × 1/2 × 1/2 = 1/8

76 © 2012 Pearson Education, Inc. Section 3.7 The sum law is used to calculate the probability of a generalized outcome that can be accomplished in more than one way The sum law states that the probability of obtaining any single outcome, where that outcome can be achieved in two or more events, is equal to the sum of the individual probabilities of all such events

77 © 2012 Pearson Education, Inc. Section 3.7 When one event depends on another, the likelihood of the desired outcome is the conditional probability

78 © 2012 Pearson Education, Inc. Section 3.7 The binomial theory The binomial theorem can be used to calculate the probability of any specific set of outcomes among a large number of potential events

79 © 2012 Pearson Education, Inc. 3.8 Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data

80 © 2012 Pearson Education, Inc. Section 3.8: Chi-Square analysis evaluates the influence of chance on genetic data Chance deviation from an expected outcome is diminished by larger sample size

81 Chi Square Analysis X 2 = ∑ O = Observed E = Expected ∑ = The sum of X 2 = Chi Square Value (O-E) 2 E

82 © 2012 Pearson Education, Inc. Section 3.8: Chi-Square Calculations and Null Hypothesis When we assume that data will fit a given ratio, we establish what is called the null hypothesis—so named because it assumes that there is no real difference between the measured values (or ratio) and the predicted values (or ratio) The apparent difference can be attributed purely to chance

83 Try This 50% of the students population at EHTHS is male, and 50% is female. Based on this information, for a class of our size, what would the expected number of male and female students be? Create a null hypothesis: © 2012 Pearson Education, Inc. There is no real difference between the male to female ratio in our class compared to the general population and that any difference is due solely to chance..

84 Solve for X 2 © 2012 Pearson Education, Inc. X 2 = ∑ O = Observed E = Expected ∑ = The sum of X 2 = Chi Square Value Males O = ___ Males E = ___ Females O = ___ Females E = ___ (O-E) 2 E (O male -E male ) 2 E male (O female -E female ) 2 E female X2=X2=

85 © 2012 Pearson Education, Inc. Section 3.8 Chi-square (  2 ) analysis is used to test how well the data fit the null hypothesis Table 3.3 shows the steps in  2 calculations for the F 2 generation of a monohybrid cross

86 © 2012 Pearson Education, Inc. Table 3.3

87 © 2012 Pearson Education, Inc. Section 3.8 Chi-square analysis requires that the degree of freedom (df) be taken into account, since more deviation is expected with a higher degree of freedom (Figure 3.11) The degree of freedom is equal to n – 1, where n is the number of different categories into which each datum point may fall What are we looking at and what are the possible outcomes we could observe? How many categories? What is our degree of freedom? Male or female, 2 categories df = n-1 df = 2-1 = 1

88 © 2012 Pearson Education, Inc. Figure 3.11

89 © 2012 Pearson Education, Inc. Section 3.8 Once the number of degrees of freedom is determined, the  2 value can be interpreted in terms of a corresponding probability value (p)

90 © 2012 Pearson Education, Inc. Figure 3.11

91 Conclusion © 2012 Pearson Education, Inc.

92 3.9 Pedigrees Reveal Patterns of Inheritance of Human Traits

93 © 2012 Pearson Education, Inc. Section 3.9 Pedigrees reveal patterns of inheritance of human traits A pedigree shows a family tree with respect to a given trait. Pedigree analysis reveals patterns of inheritance

94 © 2012 Pearson Education, Inc. Figure 3.12

95 Section 3.9 Pedigree conventions Parents are connected by a single horizontal line, and vertical lines lead to their offspring If the parents are related (consanguineous), such as first cousins, they are connected by a double line Offspring are called sibs (siblings) and are connected by a horizontal sibship line

96 © 2012 Pearson Education, Inc. Section 3.9 Twins are indicated by diagonal lines stemming from a vertical line connected to the sibship line For identical (monozygotic) twins, the diagonal lines are linked by a horizontal line Fraternal (dizygotic) twins lack this connecting line

97 © 2012 Pearson Education, Inc. Figure 3.13 Tell me something about I-3 or I-4

98 © 2012 Pearson Education, Inc. Section 3.9 Pedigree analysis Pedigree analysis of human traits has been an extremely valuable tool in human genetic studies (see Table 3.4 for some examples of human traits for which pedigree analysis is very useful)

99 © 2012 Pearson Education, Inc. Table 3.4

100 © 2012 Pearson Education, Inc. If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____. a)all green b) 1 / 4 green and 3 / 4 yellow c) 1 / 2 green and 1 / 2 yellow d) 3 / 4 green and 1 / 4 yellow e)all yellow

101 © 2012 Pearson Education, Inc. If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____. d) 3 / 4 green and 1 / 4 yellow The cross is expected to produce offspring in the genotypic proportions of 1 / 4 GG, 2 / 4 Gg, and 1 / 4 gg. Since G is dominant to g, 1 / 4 GG and 2 / 4 Gg = 3 / 4 green and 1 / 4 gg is yellow.

102 © 2012 Pearson Education, Inc. If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)? a)Cross it to a homozygous dominant mouse. b)Cross it to a mouse with the dominant trait but a similarly unknown genotype. c)Cross it to a mouse with the recessive trait. d)Cross it to a heterozygous dominant mouse. e)It cannot be determined.

103 © 2012 Pearson Education, Inc. If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)? c)Cross it to a mouse with the recessive trait. In order to identify an unknown genotype, one performs a testcross, which is a cross to a homozygous recessive individual. If there are many offspring, all with the dominant phenotype, the tested mouse is homozygous dominant. If some offspring have the recessive trait (half would be expected), the tested mouse is heterozygous.

104 © 2012 Pearson Education, Inc. In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment? a)1:2:1 b)9:3:3:1 c)1:1 d)3:1 e)2:1

105 © 2012 Pearson Education, Inc. In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment? d)3:1 While we are looking at two genes, the "G" locus cross is GG x gg. The resultant offspring will all be Gg, and have the dominant phenotype. As a result, only the Bb x Bb cross contributes to the variation. P BbGGXBbgg Gametes 1 / 2 BG, 1 / 2 bG 1 / 2 Bg, 1 / 2 bg F1 1 / 4 BBGg, 1 / 4 BbGg, 1 / 4 bBGg, 1 / 4 bbGg 3 B-Gg 1 bbGg

106 © 2012 Pearson Education, Inc. What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring? a) 1 / 2 b) 1 / 4 c) 1 / 8 d) 1 / 16 e) 1 / 32

107 © 2012 Pearson Education, Inc. What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring? d) 1 / 16 For each birth, the probability that the couple will have a homozygous recessive child is 1 / 4. Using the product law, the probability of having two such offspring is 1 / 4  1 / 4  1 / 16.

108 © 2012 Pearson Education, Inc. How many different types of gametes can be formed by the genotype AaBbCc? a)3 b)4 c)8 d)16 e)32

109 © 2012 Pearson Education, Inc. How many different types of gametes can be formed by the genotype AaBbCc? c)8 First, you must determine the number of different heterozygous gene pairs (n) involved. Once n is determined, 2 n is the number of different gametes that can be formed. Here, there are three heterozygous genes, so the correct formula is 2 3 = 8. The possible gametes are P genotypeAaBbCc Gametes ABC ABc AbC Abc aBC aBc abC abc


Download ppt "Chapter 3 Lecture Concepts of Genetics Tenth Edition Mendelian Genetics."

Similar presentations


Ads by Google