Presentation is loading. Please wait.

Presentation is loading. Please wait.

Regulation of gene expression. Gene expression Gene expression Gene expression is the process by which information from a gene is used in the synthesis.

Similar presentations


Presentation on theme: "Regulation of gene expression. Gene expression Gene expression Gene expression is the process by which information from a gene is used in the synthesis."— Presentation transcript:

1 Regulation of gene expression

2 Gene expression Gene expression Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is a functional RNA. The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archea) and viruses - to generate the macromolecular machinery for life.genegene product proteins rRNAtRNARNAeukaryotes multicellular organismsprokaryotesbacteria archeaviruses macromolecular

3 Modes of gene expression constitutive gene expression:mode is that a gene that is transcribed continually constitutive gene expression:mode is that a gene that is transcribed continually A housekeeping gene is typically a constitutive gene that is transcribed at a relatively constant level. The housekeeping gene's products are typically needed for maintenance of the cell. Housekeeping genes are used as internal standards in quantitative PCR since it is generally assumed that their expression is unaffected by experimental conditionsconstitutive gene induction and repression of gene expression induction and repression of gene expression Induction: the process of gene expression upregulated in certain conditions. DNA damage induce damage and repair-related gene expression. Repression: the process of gene expression downregulated. tryptophan repress metabolism-related gene expression.

4 of gene Temporal and spatial expression of gene : temporality : The growth process of single cell and the growth state at different external environment are accompanied by a variety of alterations of gene expression. There are also changes in multiple cells gene expression in different stages of individual development and different internal environments. : spatiality : The gene expression patterns of multiple cells which comsist different tissues and organs are very different

5 Regulation of gene expression and its modes Whether gene expression and the level of expression are carried out under stringent control of organism Regulation may happen at various levels of gene expression, but regulation of transcription regulation is the major level.

6 The basics of gene expression regulation at transcriptional level cis-acting element usually considered to be DNA sequences that, via transcription factors or other trans-acting elements or factors, regulate the expression of genes on the same chromosomeDNAtranscription factorsexpressiongeneschromosome Promoter Special regulatory element: operator Trans-acting factor :protein factors which can directly or indirectily bind to cis-acting DNA sequence to regulate gene expression RNA pclymerase activator protein or repressor protein 。

7 Section1 gene expression regulation in Prokaryotic organism Pre-transcription transcription translation modification DNA mRNA protein Active protein

8 一、 一、 Regulation at transcriptional level

9

10 Factors affecting transcription : 1. Promoter  Promoter structure  initiation site +1 binding site -10 recognition site -35  Promoter determines the direction of transcription and the template strand Promoter determines the efficiency of priming Different promoter has different RNA polymerase affinity, so different priming efficiency. consensus sequence is a way of representing the results of a multiple sequence alignment, where related sequences are compared to each other, and similar functional sequence motifs are found. The consensus sequence shows which residues are most abundant in the alignment at each position T 80 A 95 T 45 A 60 A 50 T 96 consensus sequence is a way of representing the results of a multiple sequence alignment, where related sequences are compared to each other, and similar functional sequence motifs are found. The consensus sequence shows which residues are most abundant in the alignment at each position T 80 A 95 T 45 A 60 A 50 T 96 sequence alignmentsequence motifs sequence alignmentsequence motifs

11 2. specific recognition between σ factor and promoter There is only one RNA polymerase in prokaryotes, but having a variety of σ factors. α 2 ββ , σ α 2 ββ , σ Core enzyme Core enzyme σ factors holoenzyme holoenzyme σ Different σ factors selectively recognize different promoters

12 E. Coli: Environmental changes can induce a specific σ factors, thus open a specific set of genes. σ70 recognizes conventional promoter. σ32 recognizes heat shock protein gene promoter. 42 ℃ induction of heat shock protein expression

13 3 、阻遏蛋白 ( repressor ) proteins can repress gene expression at transcriptional level : negative regulation. Repressor is a DNA-binding protein, encoded by regulatory gene (i gene). It can specifically recognize and bind to operon and the repress transcription. + —— —— binding to DNA ( or de- binding DNA ) signaling molecule + repressor protein —— allosteristuc effect —— binding to DNA ( or de- binding DNA ) induce repression induce derepression

14 4 、 4 、 positive regulatory protein Enhancing transcription after binding to specific DNA sequence : Enhancing transcription after binding to specific DNA sequence : ( 1 ) CAP : ( 1 ) CAP : catabolite gene activation protein cAMP is a signal molecule whose prevalence is inversely proportional to that of glucose. cAMP is a signal molecule whose prevalence is inversely proportional to that of glucose. in the absence of glucose, cAMP binds to the CAP, which in turn allows the CAP to bind to the CAP promoter. the prevalence of cAMP and binding of the CAP to the DNA significantly change the receptor conformation and increase the production of β-galactosidase, enabling the cell to digest the lactose needed to produce β-galactosidase

15 positive positive regulatory protein (2) Regulation of ntrC protein (2) Regulation of ntrC protein

16 5 、 inversion protein Inversion protein is a site-specific recombinase 。

17 6 、 6 、 RNA pclymerase inhibitor stringent response is a stress response that occurs in all prokaryotes and some plants in reaction to amino-acid starvation or carbon starvation. The stringent response is signaled by the alarmone (p)ppGpp, and is capable of modulating up to 1/3 of all genes in a cell. It causes the cell to divert resources away from growth and division and toward amino acid synthesis in order to promote survival until nutrient conditions improve. stringent response is a stress response that occurs in all prokaryotes and some plants in reaction to amino-acid starvation or carbon starvation. The stringent response is signaled by the alarmone (p)ppGpp, and is capable of modulating up to 1/3 of all genes in a cell. It causes the cell to divert resources away from growth and division and toward amino acid synthesis in order to promote survival until nutrient conditions improve. alarmone(p)ppGpp alarmone(p)ppGpp (p)ppGpp production is mediated by the ribosome part and the ribosome- associated protein when there are few charged tRNAs available to bind to the ribosome (p)ppGpp production is mediated by the ribosome part and the ribosome- associated protein when there are few charged tRNAs available to bind to the ribosome 空载 tRNA 空载 tRNA relA relA 魔斑核苷酸 魔斑核苷酸 RNA 聚合酶 RNA 聚合酶 rRNA 转录减少 rRNA 转录减少 氨基酸饥饿 氨基酸饥饿 核糖体生成减少 核糖体生成减少

18 7 、 attenuator Attenuator: refers to a specific regulatory sequence that, when transcribed into RNA, forms hairpin structures to stop translation when certain conditions are not met The attenuator plays an important regulatory role in prokaryotic cells because of the absence of the nucleus in prokaryotic organisms. prokaryoticnucleusprokaryoticorganisms

19 二、转录的调控机制 regulatory mechanism of transcription It was found 100 years ago that lactose could induce the production of E. coli lactose- metabolizing enzymes. Jacob and Monod proposed lactose operon (operon) model and explained it’s mechanism in The lac operon is an operon required for the transport and metabolism of lactose in Escherichia coli. It consists of three adjacent structural genes, a promoter, a and an operator. The lac operon is regulated by several factors including the availability of glucose and of lactose. Gene regulation of the lac operon was the first complex genetic regulatory mechanism to be elucidated and is one of the foremost examples of prokaryotic gene regulationoperonmetabolismlactose Escherichia colistructural genespromoter operator glucoselactoseprokaryoticgene regulation

20 lactose operon structure ( z,y,a) : structure gene ( z,y,a) : galactosidae, permease, transacetylase 。 regulatory(i) : regulatory gene (i) : repressor protein gene 。 : regulatory sequence : promotor, operator gene, CAP sequence 。

21 Metabolism of lactose

22 Regulatory gene  Cis-acting element  1. RNA polymerase binding site: -10 and -35  2. repressor binding site 。  3. CAP/CRP binding site

23 Trans-acting factors  RNA polymerase  The lac repressor en coded by lac I, lies nearby the lac operon and is always expressed (constitutive). It is a tetramer of identical subunits. Each subunit contains a helix-turn- helix (HTH) motif capable of binding to DNA. The operator site where repressor binds is a DNA sequence with inverted repeat symmetry. The two DNA half-sites of the operator together bind to two of the subunits of the tetrameric repressor, lac repressorlac repressor  lactose repressor can hinder production of β- galactosidase in the absence of lactose. β- galactosidaseβ- galactosidase  Catabolite activator protein (CAP) to greatly increase production of β-galactosidase in the absence of glucose. Catabolite activator proteinβ-galactosidase Catabolite activator proteinβ-galactosidase

24 Repression of repressor to lac operon

25 D D erepression by lactose

26 The regulational role of glucose

27 Dural regulation of Lac operon The first control mechanism is the regulatory response to lactose, which uses repressor to hinder production of β-galactosidase in the absence of lactose. The lacI gene coding for the repressor lies nearby the lac operon and is always expressed (constitutive). If lactose is missing from the growth medium, the repressor binds very tightly to a short DNA sequence and interferes with binding of RNAP to the promoter, and therefore mRNA encoding LacZ and LacY is only made at very low levels. When cells are grown in the presence of lactose, however, a lactose metabolite called allolactose, which is a recombination of glucose and galactose, binds to the repressor, causing a change in its shape. Thus altered, the repressor is unable to bind to the operator, allowing RNAP to transcribe the lac genes and thereby leading to high levels of the encoded proteins.β-galactosidaseallolactose The second control mechanism is a response to glucose, which uses the CAP to greatly increase production of β-galactosidase in the absence of glucose. cAMP binds to the CAP, which in turn allows the CAP to bind to the CAP promoter, which assists the RNAP in binding to the DNA. In the absence of glucose, the prevalence of cAMP and binding of the CAP to the DNA significantly increases the production of β- galactosidase, enabling the cell to digest the lactose needed to produce glucose.β-galactosidaseβ- galactosidase dural regulation

28 IPTG is frequently used as an inducer of the lac operon for physiological work. It binds to repressor and inactivates it, but is not a substrate for β-galactosidase. One advantage of IPTG for in vivo studies is that since it cannot be metabolized by E. coli its concentration remains constant and the rate of expression of lac p/o-controlled genes, is not a variable in the experiment. IPTG intake is dependent on the action of lactose permeasein vivo

29 Regulation of trp operon Trp operon is an operon - a group of genes that are used, or transcribed, together - that codes for the components for production of tryptophan Trp operon is an operon - a group of genes that are used, or transcribed, together - that codes for the components for production of tryptophanoperontryptophanoperontryptophan Repression Repression negative repressive feedback mechanism. The repressor for the trp operon is produced upstream by the trpR gene, which is continually expressed at a low level. It creates monomers, which associate into tetramers. These tetramers are inactive and "floating" around within the cell. When tryptophan is present, it binds to the tryptophan repressor tetramers causing a change in conformation, which allows the repressor to bind the operator. This prevents RNA polymerase from binding to and transcribing the operon, so tryptophan is not produced from its precursor. When tryptophan is not present, the repressor is in its native conformation and cannot bind the operator region, so transcription is not inhibited by the repressor. negative repressive feedback mechanism. The repressor for the trp operon is produced upstream by the trpR gene, which is continually expressed at a low level. It creates monomers, which associate into tetramers. These tetramers are inactive and "floating" around within the cell. When tryptophan is present, it binds to the tryptophan repressor tetramers causing a change in conformation, which allows the repressor to bind the operator. This prevents RNA polymerase from binding to and transcribing the operon, so tryptophan is not produced from its precursor. When tryptophan is not present, the repressor is in its native conformation and cannot bind the operator region, so transcription is not inhibited by the repressor.repressoroperontetramerstryptophan repressor operatorRNA polymerasetryptophan repressor operontetramerstryptophan repressor operatorRNA polymerasetryptophan repressor Attenuation Attenuation a second mechanism of negative feedback in the trp operon. While the TrpR repressor decreases transcription by a factor of 70, attenuation can further decrease it by a factor of 10, thus allowing accumulated repression of about 700-fold. Attenuation is made possible by the fact that in prokaryotes (which have no nucleus), the ribosomes begin translating the mRNA while RNA polymerase is still transcribing the DNA sequence. This allows the process of translation to directly affect transcription of the operon a second mechanism of negative feedback in the trp operon. While the TrpR repressor decreases transcription by a factor of 70, attenuation can further decrease it by a factor of 10, thus allowing accumulated repression of about 700-fold. Attenuation is made possible by the fact that in prokaryotes (which have no nucleus), the ribosomes begin translating the mRNA while RNA polymerase is still transcribing the DNA sequence. This allows the process of translation to directly affect transcription of the operonprokaryotesnucleusribosomestranslatingmRNARNA polymerasetranscribingprokaryotesnucleusribosomestranslatingmRNARNA polymerasetranscribing

30

31 Structure of the attenuator

32 TrpL: leader transcript, the beginning of the transcribed genes of the trp operon is a sequence of 140 nucleotides.This transcript includes four short sequences designated 1-4. Sequence 1 is partially complementary to sequence 2, which is partially complementary to sequence 3, which is partially complementary to sequence 4. Thus, three distinct secondary structures (hairpins) can form: 1-2, 2-3 or 3-4. The hybridization of strands 1 and 2 to form the 1-2 structure prevents the formation of the 2-3 structure, while the formation of 2-3 prevents the formation of 3-4. The 3-4 structure is a transcription termination sequence, once it forms RNA polymerase will disassociate from the DNA and transcription of the structural genes of the operon will not occur. TrpL: leader transcript, the beginning of the transcribed genes of the trp operon is a sequence of 140 nucleotides.This transcript includes four short sequences designated 1-4. Sequence 1 is partially complementary to sequence 2, which is partially complementary to sequence 3, which is partially complementary to sequence 4. Thus, three distinct secondary structures (hairpins) can form: 1-2, 2-3 or 3-4. The hybridization of strands 1 and 2 to form the 1-2 structure prevents the formation of the 2-3 structure, while the formation of 2-3 prevents the formation of 3-4. The 3-4 structure is a transcription termination sequence, once it forms RNA polymerase will disassociate from the DNA and transcription of the structural genes of the operon will not occur.hairpinstranscription terminationhairpinstranscription termination

33

34 Regulation of attenuator

35

36 三、 R 三、 R egulation at translational level effect of S-D sequence on the translation stability of mRNA the role of mRNA interfering complementary RNA (mic RNA) effect of translation products on translation

37 1 、 the location ofS-D sequence 1 、 the location of S-D sequence S-D sequence S-D sequence

38 the location ofS-D sequence the location of S-D sequence the distance between S-D sequence and initiation codon 7 or 8bp between SD sequence and initiation, the translation efficiency of a 500 times difference for recombinant IL-2 expression. the distance between S-D sequence and initiation codon 7 or 8bp between SD sequence and initiation, the translation efficiency of a 500 times difference for recombinant IL-2 expression.  the structure of mRNA may hide SD sequence, thus affecting the translation.

39 Regulation of mRNA stability T1/2 of mRNA in bacteria is short (ca 2min),regulation mechanism for rapid protein degradation is essential. Once the induction factors removed, the translation will stop. T1/2 of mRNA in bacteria is short (ca 2min),regulation mechanism for rapid protein degradation is essential. Once the induction factors removed, the translation will stop. Different degradation mechanisms are responsible for different mRNA degradation. Different degradation mechanisms are responsible for different mRNA degradation. RNAse involed in mRNA degradation : RNAse involed in mRNA degradation :  RNase I : single-strand specific endonuclease 。  RNase II : 3’end of single strand-specific exonuclease 。  RNase III : double-strand specific endonuclease

40 3 、 Regulation of small-molecule RNA Bacteria express ompF at low osmotic pressure, while expression of ompC at high osmotic pressure. The expression of ompC inhibits ompF expression by micRNA.

41 mechanism of micRNA hypotension Hypertonic Hypertonic ompR ompR ompF ompF ompC ompC ompF ompF 启动子 启动子 mRNA mRNA ompC ompC mRNA mRNA ompC ompC 启动子 启动子 micF micF 启动子 启动子 micF micF micRNA micRNA 启动子 启动子 ompF ompF mRNA mRNA micRNA micRNA osmotic pressure leads to allosterism

42 4 、 4 、 The regulation of translation products to the translation Translation termination factor RF2 regulates translation itself: RF1: recognize UAG and UAA RF2: recognize UGA and UAA 5’…GUUCUUAGGGGGUAUCUUUGACUACGAC…3’ NH 2 …Val Leu Arg Gly Tyr Leu Asp Tyr Asp…COOH

43 Section II regulation of gene expression in eukaryote The regulation level of gene expression in eukaryote pro-transcription transcription translation modication DN A hnRN A mRN A protein activity Processing posttranscription

44 The characteristics of gene expression regulation in Eukaryote Diversity of regulatory signal : Diversity of regulatory signal : Prokyrote:Gene expression in prokyrote is regulated by enviroment and thus realized by enzyme expression Prokyrote:Gene expression in prokyrote is regulated by enviroment and thus realized by enzyme expression eukyrote : extracellular enviroment change eukyrote : extracellular enviroment change cell communication 。 cell communication 。 Complexicity of regualory mechanism : Complexicity of regualory mechanism : More complex cis-acting elements and trans-cis factors More complex cis-acting elements and trans-cis factors More levels and more modes of regulation More levels and more modes of regulation

45 一 、 regulation at the pre-transcriptional level Loss of chromosome: Changes of chromatin structure Euchromatin and heterochromatin Histone modification: changes in structure of nucleosome. DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. As such, it is part of the epigenetic code and is also the best characterized epigenetic mechanism. methylation of CpG sequences Gene rearrangement occurs in vertabrate, which randomly selects and assembles segments of gene encoding specific protein with important roles in the immune system. This site-specific recombination reaction generates a diverse repertoire of T cell receptor (TCR) andimmunoglobulin (Ig) molecules that are necessary for the recognition of diverse antigen from bacterial,viral and parasitic invaders, and from dysfunctional cells such as tumor cells. Gene duplication (or chromosomal duplication or gene amplification) is any duplication of a region of DNA that contains a gene; it may occur as an error in homolgous recombination, a retrotranslocation event, or duplication of an entire chromosome.

46 1 、 Chromatin loss Occurred in inferior animals,such as protozoa, nematodes and insects, etc. the whole or part of the chromosome lose in somatic cell. Chromosome set of germ cell is retained.

47 2 、 E 2 、 Effect of chromatin structure on gene expression Heterochromatin and euchromatin: Heterochromatin highly condensed Its genes do not express and is insensitive to DNase I digestion. Euchromatin can be transcribed and is sensitive to DNase I digestion. Effect of nucleosome structure on gene expression.

48 Effect of nucleosome structure on gene expression  Association and disassociation of nuclesome is related to acetylation, methylation and phospholation of histone :  acetylation : Occurred in H2A/2B/3/4 , acetylation increase in S phase 。 Occurred in H2A/2B/3/4 , acetylation increase in S phase 。 Histone acetyl transferase (HAT) may coordinate other transcription factor to activate transcription Histone acetyl transferase (HAT) may coordinate other transcription factor to activate transcription :  phosphorylation : Mainly occurred in H1, H1 phospholation increase in M phase Mainly occurred in H1, H1 phospholation increase in M phase

49 3 、 DNA methylation DNA methylation is essential for normal development and is associated with a number of key processes including geneomic imprinting, X- chromosome inactivation, suppression of repetitive elements and carcinogenesis. DNA methylation is essential for normal development and is associated with a number of key processes including geneomic imprinting, X- chromosome inactivation, suppression of repetitive elements and carcinogenesis. Between 60% and 90% of all CpGs are methylated in mammals.Unmethylated CpGs are grouped in clusters called “CpG island" that are present in the 5' regulatory region of many genes. Between 60% and 90% of all CpGs are methylated in mammals.Unmethylated CpGs are grouped in clusters called “CpG island" that are present in the 5' regulatory region of many genes. Alterations of DNA methylation have been recognized as an important component of cancer development. Hypomethylation generally arises earlier and is linked to chromosomal instability and loss of imprinting, whereas hypermethylation is associated with promoters and can arise secondary to gene (oncogene suppressor) silencing, but might be a target for epigenetic therapy. Alterations of DNA methylation have been recognized as an important component of cancer development. Hypomethylation generally arises earlier and is linked to chromosomal instability and loss of imprinting, whereas hypermethylation is associated with promoters and can arise secondary to gene (oncogene suppressor) silencing, but might be a target for epigenetic therapy.

50 DNA methylation DNA methylation may impact the transcription of genes in two ways. DNA methylation may impact the transcription of genes in two ways. First, the methylation of DNA may itself physically impede the binding of transcriptional proteins to the gene First, the methylation of DNA may itself physically impede the binding of transcriptional proteins to the gene secondly, methylated DNA may be bound by proteins known as methyl-CpG- binding domain proteins (MBDs). MBD proteins then recruit additional proteins to the locus, such as histone deacetylases and other chromatin remodelling proteins that can modify histones, thereby forming compact, inactive chromatin termed silent chromatin. This link between DNA methylation and chromatin structure is very important. In particular, loss of methyl-CpG-binding protein 2 (MeCP2) has been implicated in Rett syndrome and methyl-CpG binding domain protein 2 (MBD2) mediates the transcriptional silencing of hypermethylated genes in cancer. 。 secondly, methylated DNA may be bound by proteins known as methyl-CpG- binding domain proteins (MBDs). MBD proteins then recruit additional proteins to the locus, such as histone deacetylases and other chromatin remodelling proteins that can modify histones, thereby forming compact, inactive chromatin termed silent chromatin. This link between DNA methylation and chromatin structure is very important. In particular, loss of methyl-CpG-binding protein 2 (MeCP2) has been implicated in Rett syndrome and methyl-CpG binding domain protein 2 (MBD2) mediates the transcriptional silencing of hypermethylated genes in cancer. 。histone deacetylasesRett syndromehistone deacetylasesRett syndrome

51 4 、 4 、 gene rearrangement immunoglobulin

52 5 、 G 5 、 G ene amplification Gene amplification: duplication of a region of DNA that contains a gene; it may occur as an error in homolgous recombination, a retrotranslocation event, or duplication of an entire chromosome Xenopus laevis oocytes rRNA gene (rDNA) amplification. Drug resistance gene amplification. proto-oncogene

53 二、 二、 Transcriptional regulation Cis-acting element trans-acting factor

54 1 、 1 、 Gene activation DNase I-sensitive sites:Because the loosen structure removed the protective effect of histones in the transcriptional activity of active chromatin regions, the sites are sensitive to DNase I digestion. DNase I-sensitive is a basic feature of transcriptional chromatin. HMG: high mobility group, is a group of chromosomal proteins that help with transcription, replication, recombination, and DNA repair. it consists of non-histone proteins of chromatin,relative with cells development differentiation.

55 2. 2. cis-acting element Promoter : In bacteria, the promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are often brought to the promoter DNA by an activator protein binding to its own DNA binding site nearby. Promoter : In bacteria, the promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are often brought to the promoter DNA by an activator protein binding to its own DNA binding site nearby.sigma factorsigma factor In eukyrotes, the process is more complicated, and at least seven different factors are necessary for the binding of an RNA polymerase II to the promoter In eukyrotes, the process is more complicated, and at least seven different factors are necessary for the binding of an RNA polymerase II to the promoter Enhancer: a short region of DNA that can bind proteins called an activators, binding of activators to this enhancer region can initiate the transcription of a gene that may be some distance away from the enhancer, or can even be on a different chromosome. The increase in transcription is due to the activators recruiting transcription factors, which enhances the binding of RNA polymerase Enhancer: a short region of DNA that can bind proteins called an activators, binding of activators to this enhancer region can initiate the transcription of a gene that may be some distance away from the enhancer, or can even be on a different chromosome. The increase in transcription is due to the activators recruiting transcription factors, which enhances the binding of RNA polymerase Silencer: a DNA sequence capable of binding transcription regulation factors. Upon binding, RNA polymerase is prevented from initiating transcription thus decreasing or fully suppressing RNA synthesis Silencer: a DNA sequence capable of binding transcription regulation factors. Upon binding, RNA polymerase is prevented from initiating transcription thus decreasing or fully suppressing RNA synthesis

56 ( 1 ) ( 1 ) promoter Core sequence : the minimal portion of the promoter required to properly initiate transcription Core sequence : the minimal portion of the promoter required to properly initiate transcription TATA box is also called Hogness box. transcription Start Site (TSS) Approximately -25 A binding site for RNA polymerase TATA box is necessary for the maintenance of basal transcription..

57 ( 2 ) ( 2 ) upstream promoter element(UPE) Upstream promotor elements(UAS) : It is a specific DNA sequence in the upstream of TATA box.It can be bound with a number of trans- acting factors and has a strong regulation for the initiation of transcription. Promoter may have more than one UAS.It must be in the vicinity to the upstream of promoter. GC box appears frequently in house-keeping genes.

58 ( 3 ) enhancer Enhancer,also known as distal enhancer element, plays its role far from the promoter core sequence. Enhancer was first found in SV40 virus : enhancerGCGC GC TATA TATAenhancer 72 bp 72 bp GGTGTGGAAAG GGTGTGGAAAG ATGCAAAG ATGCAAAG Core sequence Core sequence octamer octamer AP1binding site AP1binding site

59 characterics characterics of enhancer works both in short or long distance : even 50kb outside. It can be located upstream, downstream or even in the intron. No restriction for its direction itself. It works only when bound to trans-acting factors a species-specific and tissue-specific working way.

60 The specificity of enhancer Enhancer of Ig light chain and heavy chain gene show activity in B cell only. Insulin gene enhancer shows activity in beta Cell of islet only. β-globin gene cluster enhancer has different activity at different developmental stages.

61 ( 4 ) ( 4 ) response element A response element is a short sequence of DNA within the promoter of a gene that is able to bind a specific hormone receptor complex or other small molecule and therefore regulate transcription : HRE heat shock response element : HRE : GRE glucocorticoid responsive element : GRE : MRE metal response element : MRE : TRE phorbol ester response element : TRE : SRE serum response element : SRE : CRE cAMP response element : CRE

62 ( 5 ) silencer It is a negative regulatory element, seldom found in eukaryotes. Binding of silencer to trans-acting factors is necessary for its inhibition of transcription. It is a negative regulatory element, seldom found in eukaryotes. Binding of silencer to trans-acting factors is necessary for its inhibition of transcription. modificational sites of chromatin, including the deacetylation of histone. modificational sites of chromatin, including the deacetylation of histone.

63 3 、 3 、 trans-acting factor Characterics of trans-acting factor Nucleus protein factors DNA binding domain recognizing cis-acting element A small quantity Positive or negative regulation The main features of their structures DNA binding domain Transcriptional activiting domain other protein-binding domain

64 trans-act factor RNA pclymerase : RNA pol I/II/III 。 RNA pclymerase : RNA pol I/II/III 。 Cofactor of RNA polymerase, it is necessary for basal transcription to combine with core sequence of the promoter. : transcription activating factor(TAF) and transcription repressing factor : binding to UAS to regulate the transcriptional activity. : coactivator and corepressor : Do not bind DNA, binding of transcription factor or transcriptional activator / repressor factor instead of DNA sequence.

65 ( 1) RNA pclymerase RNA polymerase II: specifially responible for nuclear gene transcription, consisting of 12 subunits, 200kd of which is homologous to prokaryotic β subunit. It requires a variety of regulatory proteins in a synergistic way. Basal level transcription: 30 kinds of peptides Regulatory transcription: more polypeptides.

66 (2) (2) transcription factor TFII is a class of transcription factors is in synergy with the RNA polymerase II.

67 Pre- Pre-initiation complex

68 structural feature of the trans-acting factor DNA-binding domain zinc fingers helix-turn-helix leucine zipper helix-loop-helix transcription activating domain Acidic region with α-helix Gln-rich domain Pro-rich domain

69 zinc-finger motif conservative amino acids residues, containing four Cys, or two Cys, or two His. DNA-binding domain has multiple zinc fingers. It can be classified into: Zn 2+ Zn 2+ Cys Cys His His Cys2/Cys2Cys2/His2

70 conformation of the zinc-finger motif

71 zinc fingers binding to DNA Zinc finger structure is the most motif of trans-acting factor for DNA- binding. Zinc finger structure is the most extensive motif of trans-acting factor for DNA- binding.  TF III A : 9 His 2 /Cys 2  SP1 : 3 His 2 /Cys 2 :  glucocorticoid receptor;GR :  2 Cys 2 /Cys 2 :  estrogen receptor :  2 Cys 2 /Cys 2

72 helix-turn-helix motif (HTH motif) helix-turn-helix (HTH) is a major structure motif capable of binding DNA. It is composed of two α helices joined by a short strand of amino acids and is found in many proteins that regulate gene expression.α helices It was first discovered in prokaryotes, such as: CAP, AraC ect. Similar structure found in the fruit fly is called homeobox.

73 leucine zipper A leucine zipper, is a super-secondary structural motif found in proteins that creates adhesion forces in parallel alpha helices. It is a common dimerization domain found in some proteins involved in regulating gene expression. Leucine zippers are found in both eukaryotic and prokaryotic regulatory proteins but are mainly a feature of Eukaryotes. An amphipathic alpha helix is formed with a hydrophobic region at one side having basic aminoacids. This hydrophobic region provides an area for attachment of 2 polypeptides. A leucine zipper, is a super-secondary structural motif found in proteins that creates adhesion forces in parallel alpha helices. It is a common dimerization domain found in some proteins involved in regulating gene expression. Leucine zippers are found in both eukaryotic and prokaryotic regulatory proteins but are mainly a feature of Eukaryotes. An amphipathic alpha helix is formed with a hydrophobic region at one side having basic aminoacids. This hydrophobic region provides an area for attachment of 2 polypeptides. CREB , C/EBP 、 AP1 、 Jun/Fos CREB , C/EBP 、 AP1 、 Jun/Fos

74 helix-loop-helix motif(HLH motif) The motif is characterized by two α-helices connected by a loop. In general, transcription factors including this domain are dimeric, each with one helix containing basic amino acid residues that facilitate DNA bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG. The canonical E-box is CACGTG (palindromic), however some bHLH transcription factors bind to non- palindromic sequences, which are often similar to the E-box. The motif is characterized by two α-helices connected by a loop. In general, transcription factors including this domain are dimeric, each with one helix containing basic amino acid residues that facilitate DNA bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG. The canonical E-box is CACGTG (palindromic), however some bHLH transcription factors bind to non- palindromic sequences, which are often similar to the E-box.α-helices consensus sequencepalindromicα-helices consensus sequencepalindromic Myc/Max 。 Myc/Max 。 Igκ chain gene enhancer (κE)-binding protein E12/E47.

75 characteristics of transcriptional activation domain Acidic α-helix domain Glutamine-rich domain Proline-rich domain

76 3 Activity regulation of trans-acting factors phosphoralytion and de- phosphoralytion CREB phosphoralytion : phosphoralytion and de- phosphoralytion CREB phosphoralytion :  cAMP activates PKA and thus CREB phosphoralytion happened and to form active dimer  NF-κB dephosphoralytion in cytosol---inactive  NF-κB phosphoralytion in nucleus---active  Expressional regulation of transcriptional factors : synthesis when needed and degraded rapidly, can not accumulate in cell synthesis when needed and degraded rapidly, can not accumulate in cell  Ligand binding : binding of hormone to its receptor

77 Interaction between trans-acting factor looping theory: Two rather separated cis- acting elements binding to their trans- acting factors respectively to shorten their spatial distance to form a loop and thus play their regulational role The formation of loop is mediated by protein-protein interaction interaction of trans-factors.

78

79 三、 三、 Regulation at post-transcriptional level Cap structure : Cap structure : To prevent mRNA degradation, to extend the life of mRNA Binding to small subunit of ribosome recognization by recognization by translational initiation factor. (1) Poly (A) tail (1) protection (2) (2) transferring 。 : intron splicing : alternative splicing

80 1.m7G(5, )ppp (5, )N 1 mpN 2 m … , cap m7G(5, )ppp (5, )N 1 mpN 2 m … ,

81 2 、 2 、 Poly (A) tail

82 3 、 3 、 intron splicing

83 Alternative splicing is a process by which the exons of the RNA produced by transcription of a gene (a primary gene transcript or pre-mRNA) are reconnected in multiple ways during RNA splicing. The resulting different mRNA may be translated into different protein isoform; thus, a single gene may code for multiple proteins Alternative splicing is a process by which the exons of the RNA produced by transcription of a gene (a primary gene transcript or pre-mRNA) are reconnected in multiple ways during RNA splicing. The resulting different mRNA may be translated into different protein isoform; thus, a single gene may code for multiple proteins alternative retention of exons. alternative retention of intron. Exons mutually exclusive : two exons retain one. Alternative splicing sites : change the splicing sites, retain some introns or not. alternative retention of exons. alternative retention of intron. Exons mutually exclusive : two exons retain one. Alternative splicing sites : change the splicing sites, retain some introns or not.

84

85 四 、 regulation at translational level Regulation of repressor protein the regulation of mRNA stability Influence of mRNA Structure on translation The secondary structure of 5’ end untranslated region (UTR) can affect translation efficiency. the distance between cap structure and AUG can affect the translation efficiency.. Translation efficiency is proportional to the distance ranging 17-80nt

86 1 、 1 、 Regulation of repressor Repressor binds to mRNA 5 'untranslated region to prevent translation. There are iron-response elements in mRNA 5’ end of ferritin mRNA. The element can bind to regulatory iron-binding protein and form the hairpin structure and translation is inhibited. Ferritin binding to this protein leads to dissociation of regulatory proteins from mRNA and translational efficiency of mRNA increases 100 times.

87

88 2 、 translation Regulation of 5’-AUG There are one or more AUG in the upstream of 5 'end untranslated region, designated 5’AUG. Only non-active peptides can be translated starting from the 5'AUG translation usually. 5'AUG and initiation codon both have a certain probability to be the translational starting codon. 5'AUG can reduce starting translation efficiency of normal AUG and maintained translation at a lower level.

89 3 、 Influence of the length of mRNA 5'UTR The distance between cap structure and AUG may affect the translation efficiency. Less than 12nt, the lower efficiency Translation efficiency is proportional to the distance ranging 17-80nt.

90 4 、 Regulation of mRNA stability t 1/2 mRNA in eukaryotic cells: 30min-10hr mRNA 3’-untranslated region structure effects its stability The A and U-rich regulational sequence combines with specific proteins can promote RNA degradation and this mRNA is instability The stem-loop structure of histone mRNA 3’- untranslated region It can reduce the degradation of mRNA through this way when DNA synthesize.

91 五、 Regulation in post-translational level A signal peptide is a short (3-60 amino acid long) peptide chain that directs the transport of a protein. Signal peptides may also be called targeting signals, signal sequences, transit peptides, or localization signals. The amino acid sequences of signal peptides direct proteins (which are synthesized in the cytosol) to certain organelle such as the nucleus, mitochondria matrix, endoplastic reticulum, and peroxisome. Some signal peptides are cleaved from the protein by signal peptidase after the proteins are transported  SP into the ER: It is located in N-terminal of protein with 5-10 hydrophobic amino acids SP into the Mit: amino acids with positive electricity are alternating with hydrophobic amino acids. There is a amino acid with positive electricity every 3- 5 hydrophobic amino acids SP into the nucleus: There are clusters of amino acids with positive electricity

92 the signal hypothesis SRP : Signal peptide recognitional particle, consised of six different proteins and 7s-RNA SRP : Signal peptide recognitional particle, consised of six different proteins and 7s-RNA DP : SRP-Receptor DP : SRP-Receptor

93 2 、 Covalent modification of amino acids in polypeptide chain Phosphorylation, glycosylation, acetylation, methylation etc.

94 3 、 Hydrolysis of nascent polypeptide chain Enzyme hydrolysis The first amino acid of N-ternimal the first amino acid of N-extrem stable amino acids: Met, Ser, Thr, Ala, Val, Cys, Gly, Pro Instable amino acids: the rest 12 amino acids Aminoacyl-tRNA-protein transferase


Download ppt "Regulation of gene expression. Gene expression Gene expression Gene expression is the process by which information from a gene is used in the synthesis."

Similar presentations


Ads by Google