Presentation is loading. Please wait.

Presentation is loading. Please wait.

Scotty Merrell Department of Microbiology and Immunology B4140 Regulation of Gene Expression I.

Similar presentations


Presentation on theme: "Scotty Merrell Department of Microbiology and Immunology B4140 Regulation of Gene Expression I."— Presentation transcript:

1 Scotty Merrell Department of Microbiology and Immunology B4140 Regulation of Gene Expression I

2 1.Why does the expression of genes need to be regulated? QUESTIONS 3.How is the expression of genes regulated? 2.Why is it important to study gene regulation? 4.How do we study gene regulation?

3 Pathogenic bacteria: External reservoirHost Infection site #1Infection site #2 Bacteria experience different conditions depending on environment

4 1.Why does the expression of genes need to be regulated? QUESTIONS 3.How is the expression of genes regulated? 2.Why is it important to study gene regulation? 4.How do we study gene regulation?

5 Pathogenic bacteria produce virulence factors when they sense they are inside of a host Vibrio cholerae, the cause of cholera, produces toxin inside of the host. Understanding regulation of expression of this toxin is a means of understanding ways to prevent its production. ICDDR,B

6 1.Why does the expression of genes need to be regulated? QUESTIONS 3.How is the expression of genes regulated? 2.Why is it important to study gene regulation? 4.How do we study gene regulation?

7 Regulation of Gene Expression

8

9

10 RNA polymerase-promoter interactions Some promoters contain UP elements that stimulate transcription through direct interaction with the C-terminal domains of the  subunits of the RNA polymerase

11 Promoter with a full UP element containing two consensus subsites. Promoter with an UP element containing only a consensus proximal subsite. Promoter with an UP element containing only a consensus distal subsite. Arrangement of  subunits on UP elements

12 Genes come in two main flavors: 1.Constitutively expressed (transcription initiation is not regulated by accessory proteins) 2.Regulated (transcription initiation is regulated by accessory proteins) a. Negatively Regulated--Repressor Protein b. Positively Regulated--Activator Protein

13 Mechanisms of Regulation of Transcription Initiation: Negative Regulation RNA Polymerase

14 Mechanisms of Regulation of Transcription Initiation: Negative Regulation Repressor Co-repressor Repressor Inactivator

15 The lac operon a model for negative regulation A bacterium's prime source of food is glucose, since it does not have to be modified to enter the respiratory pathway. So if both glucose and lactose are around, the bacterium wants to turn off lactose metabolism in favor of glucose metabolism. There are sites upstream of the lac genes that respond to glucose concentration. This assortment of genes and their regulatory regions is called the lac operon.

16

17

18

19 The lac promoter and operator regions

20 Lac Repressor (monomer) (tetramer) The Lac Repressor is constitutively expressed Repressor binding prevents transcription

21 When lactose is present, it acts as an inducer of the operon. It enters the cell and binds to the Lac repressor, inducing a conformational change that allows the repressor to fall off the DNA. Now the RNA polymerase is free to move along the DNA and RNA can be made from the three genes. Lactose can now be metabolized. Remember, the repressor acts as a tetramer

22 When the inducer (lactose) is removed, the repressor returns to its original conformation and binds to the DNA, so that RNA polymerase can no longer get past the promoter to begin transcription. No RNA and no protein are made. Remember, the repressor acts as a tetramer

23 1. Mutation in the regulatory circuit may either abolish expression of the operon or cause it to occur without responding to regulation. 2. Two classes of mutants: A. Uninducible mutants: mutants cannot be expressed at all. B. Constitutive mutants: mutants continuously express genes that do not respond to regulation. 3. Operator (lacO): cis-acting element Repressor (lacI): trans-acting element How to identify the regulatory elements?

24 cis-configuration: description of two sites on the same DNA molecule (chromosome) or adjacent sites. cis dominance: the ability of a gene to affect genes next to it on the same DNA molecule (chromosome), regardless of the nature of the trans copy. Such mutations exert their effect, not because of altered products they encode, but because of a physical blockage or inhibition of RNA transcription. trans-configuration:description of two sites on different DNA molecules (chromosomes) or non-contiguous sites. Definitions:

25 Constitutive mutants: do not respond to regulation. Would this be a cis-dominant or recessive mutation?

26 Constitutive mutants can be recessive

27 lacI + mRNA lacI - Pi P OlacYlacZlacA mRNA X Constitutive mutants can also be dominant if the mutant allele produces a “bad” subunit, which is not only itself unable to bind to operator DNA, but is also able to act as part of a tetramer to prevent any “good” (wild type LacI) subunits from binding. et al.

28 Think about how you could determine whether a mutation was dominant or recessive.

29 Questions about negative Regulation of lac ?

30 Mechanisms of Regulation of Transcription Initiation: Positive Regulation RNA Polymerase

31 Mechanisms of Regulation of Transcription Initiation: Positive Regulation RNA Polymerase Activator

32 The lac operon a model for positive regulation When levels of glucose (a catabolite) in the cell are high, a molecule called cyclic AMP is inhibited from forming. So when glucose levels drop, more cAMP forms. cAMP binds to a protein called CAP (catabolite activator protein), which is then activated to bind to the CAP binding site. This activates transcription, perhaps by increasing the affinity of the site for RNA polymerase. This phenomenon is called catabolite repression, a misnomer since it involves activation, but understandable since when it was named, it seemed that the presence of glucose repressed all the other sugar metabolism operons.

33 CAP --- a positive regulator 1. Catabolite repression: the decreased expression of many bacterial operons that results from addition of glucose. Also known as “glucose effect” or “glucose repression”. 2. E. coli catabolite gene activator protein (CAP; also known as CRP, the cAMP receptor protein). 3. CAP-cAMP activates more than 100 different promoters, including promoters required for utilization of alternative carbohydrate carbon sources such as lactose, galactose, arabinose, and maltose.

34

35 PTS GlucoseGlucose-6-P IIA Glc -P IIA Glc OUT IN How does glucose reduce cAMP level? 1. IIA Glc -P activates adenylate cyclase. 2. Glucose decreases IIA Glc -P level, thus reducing cAMP production. 3. Glucose also reduces CAP level: crp gene is auto-regulated by CAP-cAMP. PTS - phosphoenolpyruvate-dependent carbohydrate phosphotransferase system IIA Glc - glucose-specific IIA protein, one of the enzymes involved in glucose transport.

36 Activation of expression of the lac operon

37 E. coli CAP (CRP) amino acids NH 2 - -COOH DNA-binding Helix-turn-helix AR His19 His21 Glu96 Lys101 AR2 Dimerization and cAMP-binding 1-139

38 Transcription activation by CAP at class I CAP-dependent promoters (-62) Transcription activation: 1.Interaction between the AR1 of the downstream CAP subunit and one copy of  CTD. 2.The AR1-  CTD interaction facilitates the binding of  CTD to the DNA downstream of CAP. 3.Possibly, interaction between same copy of  CTD and the    bound at the –35 element. 4. The interaction between the second  CTD and CAP is unclear. The result: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant K B, for the formation of the RNAP-promoter closed complex

39 Transcription activation by CAP at class I CAP-dependent promoters (cont.) (-103, -93, -83, or –72) Transcription activation: Possibly, the second copy of  CTD may interact with the DNA downstream of CAP, and may interact with the    bound at the –35 element. Results: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant K B, for the formation of the RNAP-promoter closed complex

40 Transcription activation by CAP at class II CAP-dependent promoters (cont.) (-42) Transcription activation: 1.Interaction between the AR1 of the upstream CAP subunit and one copy of  CTD (either  CTD I or  CTD II, but preferentially  CTD I ). The AR1-  CTD interaction facilitates the binding of  CTD to the DNA upstream of CAP. Results: increase in the binding constant K B, for the formation of the RNAP-promoter closed complex 2.Interaction between the AR2 of the downstream CAP subunit and  NTD I. Result: increase the rate constant, k f, for isomerization of closed complex to open complex.

41 Transcription activation by CAP at class III CAP-dependent promoters (-103 or –93)(-62) Transcription activation: Each CAP dimer functions through a class I mechanism with AR1 of the downstream subunit of each CAP dimer interacting with one copy of  CTD Results: synergistic transcription activation

42 Transcription activation by CAP at class III CAP-dependent promoters (cont.) (-103, -93, or -83) (-42) Transcription activation: The upstream CAP dimer functions by a class I mechanism, with AR1 of the downstream subunit interacting with one copy of  CTD; the downstream CAP dimer functions by a class II mechanism, with AR1 and AR2 interacting with the other copy of  CTD and  NTD, respectively. Results: synergistic transcription activation

43 (a) Glucose present (cAMP low); no lactose; lacIPi P OlacYlacZlacA Repressor monomer Repressor tetramer mRNA X (b) Glucose present (cAMP low); lactose present Repressor monomer Repressor tetramer mRNA Inducer High level of mRNA X Inactive repressor High (c) No glucose (cAMP high); lactose present cAMP CAP Glucose effect on the E. coli lac operon No lactose inside the cells! (inducer exclusion)!

44 (a) Glucose present (cAMP low); no lactose; lacIPi P OlacYlacZlacA Repressor monomer Repressor tetramer mRNA X (b) Glucose present (cAMP low); lactose present Repressor monomer Repressor tetramer mRNA Inducer High level of mRNA X Inactive repressor High (c) No glucose (cAMP high); lactose present cAMP CAP Glucose effect on the E. coli lac operon No lactose inside the cells! (inducer exclusion)!

45 Inducer exclusion: How does it work? 1.Uptake of glucose dephosphorylates enzyme II glc. 2.Dephosphorylated enzyme II glc binds to and inhibits lactose permease. 3.Inhibition of lactose permease prevents lactose from entering the cell. 4.Hence, the term inducer exclusion.

46 Questions about positive regulation of the lac operon?

47 Dual positive and negative control of transcription initiation: the E. coli ara operon

48 The E. coli L-arabinose operon + +

49 AraC exists in two states P1P2 Arabinose Activator Antiactivator

50 AraC acts as a positive or negative regulator based on its conformational state and binding affinity for various sites in the two promoter regions. AraC encodes the regulator AraO1 and AraO2 encode operators CAP is a CAP binding site AraI is an additional regulatory region AraBAD are the structural genes

51 If AraC concentration becomes too high, AraC will also bind to AraO1 and repress its own expression. No arabinose + arabinose In the absence of arabinose, the P1 form of AraC binds AraO2 and AraI to prevent any P2 form from binding and activating expression --this is anti-activation, not repression! In the presence of arabinsose, AraC shifts to the P2 form and binds AraI and acts to activate transcription. Therefore AraC is an Activator, Repressor and Anti-activator!!

52 The regulatory regions of the P C and P BAD promoters The domain structure of one subunit of the dimeric AraC protein

53 The P C and P BAD Regions in the presence or absence of arabinose + L -arabinose

54 Hypothetical model of the activation of the P BAD promoter 1.P BAD – class II promoter 2.Possible interactions: between the  CTD of RNAP and the CAP protein and AraC protein and DNA

55 1. Find mutations that render the regulation uninducible or constitutive. 2. Decide by performing a complementation test if the mutants are dominant or recessive. 3. If they are recessive, decide if the system is regulated by repression or by activation. A recessive mutated activator has most likely lost function: the system will become uninducible. A recessive mutated repressor has also lost function, but now the system will show constitutive expression. 4. Decide if the elements of the system act in cis or in trans to each other: are they proteins or DNA binding sites? 5. Construct a model. Strategies for Understanding Regulation

56 Questions about ara regulation?

57 A. Transcriptional control 1. Transcription initiation a) Positive b) Negative 2. Transcription termination Attenuation B. Translational control 1. Positive 2. Negative C. Post-translational control--Proteolysis Regulatory mechanisms used to control gene expression

58

59 RNAP Transcription termination players: Termination sequence RNA polymerase and sometimes the Rho (  factor ABCD PromoterOperon of 4 genesTerminator X

60 Rho-independent terminator Rho-independent terminator Rho-dependent terminator Two major types of Terminator Sequences 1. Rho-independent 2. Rho-dependent

61 Attenuation: Premature termination of transcription of operons for amino acid biosynthesis (trp, his, leu, etc.) Relies on coupled transcription and translation and RNA secondary structure

62 The trp leader mRNA encodes the LEADER PEPTIDE MetLysAlaIlePheValLeuLysGlyTrpTrpArgThrSer 5’-AUGAAAGCAAUUUUCGUACUGAAAGGUUGGUGGCGCACUUCC U CCCAUAGACUAACGAAAUGCGUACCACUUAUGUGACGGGCAAAG A GCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGA-3’ Organization of Tryptophane Biosynthesis Genes End product of the pathway

63 1234 mRNA forms secondary structures Adapted from 3 and 4 form a Rho-independent terminator Two possible alternative structures can form 2 is complementary to 1 and 3 3 is complementary to 2 and 4 2 and 3 form the Pre-emptor, which prevents Terminator formation Pre-emptor

64

65 Tryptophan absentTryptophan present

66

67 Attenuation can also occur at the level of Protein-RNA interaction: Regulation of the trp operon in Bacillus

68 Model of trp transcriptional control Binding of activated TRAP in the leader peptide results in the formation of a terminator structure

69 Take home message: Transcription of genes to produce mRNA can be controlled at the level of initiation and/or termination

70 STOP


Download ppt "Scotty Merrell Department of Microbiology and Immunology B4140 Regulation of Gene Expression I."

Similar presentations


Ads by Google