Presentation is loading. Please wait.

Presentation is loading. Please wait.

From just £19 one way!!!!. High throughput genotyping The first step.

Similar presentations


Presentation on theme: "From just £19 one way!!!!. High throughput genotyping The first step."— Presentation transcript:

1 From just £19 one way!!!!

2 High throughput genotyping The first step

3 Published online: 5 May 2003, doi: /nbt821 Nature Biotechnology: June 2003 Volume 21 Number 6 pp Multiplexed genotyping with sequence-tagged molecular inversion probes Paul Hardenbol 1, 3, Johan Banér 2, Maneesh Jain 1, 3, Mats Nilsson 2, Eugeni A Namsaraev 1, 3, George A Karlin- Neumann 1, 3, Hossein Fakhrai-Rad 1, 3, Mostafa Ronaghi 1, Thomas D Willis 1, 3, Ulf Landegren 2 & Ronald W Davis 1 1. Stanford Genome Technology Center, Stanford University, 855 California Avenue, Palo Alto, California 94304, USA. 2. The Beijer Laboratory, Department of Genetics and Pathology, Rudbeck Laboratory, Se Uppsala, Sweden. 3. Present address: ParAllele BioScience 384 Oyster Point Blvd Suite 8, S. San Francisco, California 94080, USA.

4 Parallel gene analysis with allele-specific padlock probes and tag microarrays Johan Banér, Anders Isaksson, Erik Waldenström 1, Jonas Jarvius, Ulf Landegren * and Mats Nilsson The Beijer Laboratory, Department of Genetics and Pathology, Rudbeck Laboratory, SE Uppsala, Sweden and Department of Medical Sciences, Uppsala University Hospital, SE Uppsala, Sweden

5 Fig. 2. Consensus sequences for winter and spring genotypes of the region amplified by VRN-A1-specific primers (indicated in bold-italic letters at the beginning and end of the sequence). Dots in the sequence from the spring varieties indicate identical bases with the sequences from the winter varieties. The three differences found between the ‘s’ and ‘w’ haplotypes are indicated by bold letters. AciI restriction sites are underlined. The location of the allele specific primer 361W-F is indicated in underlined italic letters. A PCR Marker for Growth Habit in Common Wheat Based on Allelic Variation at the VRN-A1 Gene J. D. Sherman, L. Yan, L. Talbert and J. Dubcovsky

6 Line Array S/W Sequence Scorpion S Cadenza S Rialto W Xi19 S Chinese Spring S Mercia W Malacca W? Synthetic S Hobbit W Cap Desprez W Thatcher S Paragon S Note Red: Spring allele (C), Green: Winter allele (T)

7 Rht 2: AGAAGCTGGAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACGAC Mercia D:AGAAGCTGGAGCAGCTCGAGATGCCCATGGGGATGGCCGGCGTGGGCGCCGGCGCCGCCCCCGACGAC Mercia D isog: AGAAGCTGGAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACGAC Malacca D AGAAGCTGTAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACAGC Wizard D AGAAGCTGTAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACAGC Rht 1 * Mercia B:AGAAGCTGGAGCAGCTGGAGATGGCCATGGGGATGGCCGGCGTGGGCGCCGGCGCCGCGCCCGACGAC Mercia B isog: AGAAGCTGGAGTAGCTGGAGATGCCCATGGGGATGGTCGGCGTGGGCGCCGGCGCCGCGCCCGACGAC Stephen allele: AGAAGCTGGAGTAGCTGGAGATGGCCATGGGGATGGGCGGCGTT

8 Line Array Scorpion Rht 2 Rht 1 Cadenza Rht 2 Rht 1 Rialto Rht 2 Rht 1 Xi19 Rht 2 Rht 1 Chinese Spring Rht 2 Rht 1 Rht2: Green is wild type Rht1: Red is wild type

9

10

11 VrnA1 Pind-g Pinb-d Gliadin + con Pinb-f Pind-c -con Dy - con Pinb-b Rht2 Dy Pinb-e –con Rht1 Mercia Scorpion Cadenza Rialto X119 Andrew Rht1: Red is wild Rht2: Green is wild VrnA: Green is winter Pinb: red is Pinb-D1a

12

13

14

15 We are currently testing a 140 loci MIPs chip consisting of : Various HMW and LMW Glutenins, Pinb-Da-g, Rht 1 and 2, 2x vrn-A1, vrn-B1, various genes involved in starch syntheses, various disease resistance genes and a whole collection of random SNPs identified at Bristol and from various laboratories throughout the wheat community. Dilution experiments suggest that there should be no reduction in signal at less than 5,000 multiplex. Single tube assays up to 10,000 could be acheivable! If we had the SNPs If you any SNPs that you wish to include please do let us have them ASAP!!

16 University of Bristol: Alex Reid Helen O’Sullivan Gary Barker Jane Coghill Advanta:Simon Berry And the various members of the wheat community for sharing their SNPs Acknowledgements


Download ppt "From just £19 one way!!!!. High throughput genotyping The first step."

Similar presentations


Ads by Google