Presentation is loading. Please wait.

Presentation is loading. Please wait.

Cracking the code: The Speed Gene Revealed Dr. Emmeline Hill Equinome Ltd., NovaUCD, Belfield Innovation Park, Belfield, Dublin 4

Similar presentations


Presentation on theme: "Cracking the code: The Speed Gene Revealed Dr. Emmeline Hill Equinome Ltd., NovaUCD, Belfield Innovation Park, Belfield, Dublin 4"— Presentation transcript:

1

2 Cracking the code: The Speed Gene Revealed Dr. Emmeline Hill Equinome Ltd., NovaUCD, Belfield Innovation Park, Belfield, Dublin 4 Email: Emmeline.Hill@equinome.com

3 The horse genome: the complete complement of genetic material

4 TTATATTTCCCTAATTATACAGCACTAAAAATAATTTAATACAACAAATACAATTCTTTCTATTTCAAATGTTTGCCTAAATAATATAAAATCTTAATTTCTGAGGAAGTAACATTTCAACTTTTTTA AGTATGAAGTGTAAATTAAGATTTACTTATTTAAATTATAACTTGAGTTTCACATATAAAGATAAGATTTAAGTGTAGTTTATTTTATTGTTAACACAGACTTTAATTTTTCAAATATCACATTATC TTTCTTATTTATAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCAT TGTGGAGCAGGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAAGTTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACTGTAC AGGCATTAAAATTTTGCTTGGCATTGCTCAAAAGCAAAAGAAAAGTAAAAGGAAGAAATAAGAGCAAGGAAAAAGATTGAACTGATTTTAAAATCTGCAAAAACTGCAAATCTATGTTTATA TTTACCTGTTTGTGCTGATTCTTGCTGGTCCAGTGGATCTAAATGAGAACAGCGAGCAAAAAGAAAATGTGGAAAAAGAGGGGCTGTGCAATGCATGTACTTGGAGACAAAACACTAAATCTT CAAGAATAGAAGCCATAAAAATTCAAATCTCAGTAAACTGCGCCTGGAAACAGCTCCTAACATCAGCAAAGATGCTATTAGACAACTTTTGCCCAAAGCTCCTCCACTCCGGGAACTGATTGAT CAGTACGATGTCCAGAGAGATGACAGCAGTGATGGCTCTTTGGAAGATGATGATTACCACGCGACGACGGAAACAATCATTACCATGCCTACAGAGTGTAAGTAGTCCTGTTAGTGTATATCA ACAATTCTGCTGACTGTTGTTCTAGTGTTTATGAGAAACAGATCTATTTTCAGGCTCTTTTAACAAGCTGTTGGCTTGTATGTAAGCAGGAAGGAAAAGAGTTTCTTTTTTTCAAGATTTCATGAG AAATTTACTAATGAGACTGAAATCTGCTGCATTATTTGTTTTCTTAGAGAGCTAAAAAGCTAAACAAAATAAAATTCTTGCACAGCATTAATATTATTTAGTTTAATATGACAAATATAACATGC TTATGCTTTCACAGCTTAATACCACCAAGGCAAAAATTGGGAGATAGTACAAGCAATGTTAAAAACTTACATGAGATTTCATAATTGCGTTTGGTTGCCTAAAATAAGCATTTATAATAACAAG TTTTTTTCACTAATAATAGAGAAGGAAGAAATTTGTAGACGTTTAGGTCATTTGAGCATTTGCTGAACACCAAAATGACTTCTGTTACTCAAAACTATTTCTCATAGTGTTTTTATGTTCTTCACA AATTAACATATTAGATTTTGAAAGTTATTCCCCTGGAGATTAGGAAAAATATTTTTTAAAATTTAATGTATTAGTAAGAAAAATGATGAAGTAAACATAGCATAATGATAATCATGAGCTAATT ATCATAAAATGCCTAATAAATAAACATTTTAATCAAAGAGGTTATAGCTCAGAGTCCTGCTTACACCTTGACCATAGTACTATTGTTGAGAGCACCCGGGGTGCACATTTCCAGGCAGGCACATT GCTTAATAATCTCCTAAAATACAATTTTATTCTTCTTGGGAGGGAGGACTACTACCTGTAGTATCTATATTGCTTCTGAAAGATAATATATTTCATATATTCTTTTTGCAGTCAGTTCATAACTACA CTCAAGGAAAGGGAGACAGACACCTTCACAGAGAAGGCATGACACGGAAGATTCTGTGCCATGTGTCTGCGATCCTGCTTTACCCAGTGCTTTATCTACTTTAAACAGGACACAACAGTTTCAA AATATTGTTCTCCTTATTAAGTAATCAGGTTATAATGCACCAAATAATTTTCCTTTATGACTCTGCTATCAAATAGTCCTGGAGTAGATTTACCTTATTTATAAACAATCTTGGGGAACCAAAATA AAAGAAATTGCTAGTGATTTTGCTCACAATGACAGCCTGGCTCTAAAGACAGTATTTTCTAACTTTTGAGATAGCCTGAATATAACATTCAAATTTTTGTGCTAATTACTTGCTTAGCTTTGTTCCT TTAAAAGGCTATTCCAAAGCCAAAACATAACAGATGTACTATATTTTCTCTTAATTCCCGAGGCTCAGTTAGTTCCTCAGTGTGTCTTGTCCCCAGGTAATTCAGGCCTGGGGGAAGGGTTCCTTC TTCCAGACTGATTGGTACAGCTGCTCAGTAAGTGTAACTACTCAGATTCCCAAAGAATTCTAAGTGGATGTTCCTCCACGGTGTCTCTTGTTCTCTCTAATCATCATCATTTTAAAATTTCATCCAC AGTTCATTCCTTCATAGAATTTTCCTTAGTTCACAGTTTTCTGGAAAAGAAGTAGATTCCTCATAAACAGCTGAAAAAACATATATCAAAAATTCTGAAAGGCTAGAGTAATTATATTCTTTGATA TTTTTCTGAGTTATGAATGAAATTCTACATAGTTTTTCACTTTAAAAGACTAAATATATATTCAGTATTCCAATGGAAAAAAAATGTTCACCAACTAATATGGAAGGGTTTACTAATTTTTTATGA TAAATAATTTCAATAACTCTTTTTCTTTTCTTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAGCTCTAAAATACAATACAATAAAGTAGTA AAGGCCCAACTGTGGATATATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTGGAATCCGATCTCTGAAAC TTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTC ATGATCTTGCTGTAACCTTCCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCATCATGTGAATGAATAATAGTGGAAAATC ACTACCAGTTTCCTATGCTAACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAATGAAACACCCTCTTGATATGTCAACTTTGC ATGAGGATTAAAAAAACGTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCCACATAATTATATGAATAAAAACACAAAA TCTTCACAATGGATTCTTGTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCAGAGTAAAACTTTAAAAATTATAATTAAA ATACAATGCTTTTATTTATAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAATATACCATATTCAAGGTCCCTCATGATAAATATGTTCATTATGTTCATTATTTTGCAGGCTGTTGAT GCATTGATGTTTCTGTAGATTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAGCTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAA CTGTGGATATATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTGGAATCCGATCTCTGAAACTTGACATGA ACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTG CTGTAACCTTCCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCATCATGTGAATGAATAATAGTGGAAAATCACTACCAGT TTCCTATGCTAACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAATGAAACACCCTCTTGATATGTCAACTTTGCATGAGGATT AAAAAAACGTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCCACATAATTATATGAATAAAAACACAAAATCTTCACAAT GGATTCTTGTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCAGAGTAAAACTTTAAAAATTATAATTAAAATACAATGC TTTTATTTATAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAATATACCATATTCAAGGTCCCTCATGATAAATATGTTCATTATGTTCATTATTTTGCAGGCTGTTGATGCATTGATG TTTCTGTAGATTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAGCTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAACTGTGGATA TATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCG CTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTT CCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCATCATGTGAATGAATAATAGTGGAAAATCACTACCAGTTTCCTATGCT AACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAATGAAACACCCTCTTGATATGTCAACTTTGCATGAGGATTAAAAAAAC GTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCCACATAATTATATGAATAAAAACACAAAATCTTCACAATGGATTCTT GTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCAGAGTAAAACTTTAAAAATTATAATTAAAATACAATGCTTTTATTTA TAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAATATTTCCCTAATTATACAGCACTAAAAATAATTTAATACAACAAATACAATTCTTTCTATTTCAAATGTTTGCCTAAATAATATA AAATCTTAATTTCTGAGGAAGTAACATTTCAACTTTTTTAAGTATGAAGTGTAAATTAAGATTTACTTATTTAAATTATAACTTGAGTTTCACATATAAAGATAAGATTTAAGTGTAGTTTATTTT ATTGTTAACACAGACTTTAATTTTTCAAATATCACATTATCTTTCTTATTTATAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTT GTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAGGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAAGTTGGAATATAAAAAGCCACTTGGAATACAGTATA AAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACTGTACAGGCATTAAAATTTTGCTTGGCATTGCTCAAAAGCAAAAGAAAAGTAAAAGGAAGAAATAAGAGCAAGGAAAAAGATTGAAC TGATTTTAAAATCTGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTGTGCTGATTCTTGCTGGTCCAGTGGATCTAAATGAGAACAGCGAGCAAAAAGAAAATGTGGAAAAAGAGGGG CTGTGCAATGCATGTACTTGGAGACAAAACACTAAATCTTCAAGAATAGAAGCCATAAAAATTCAAATCTCAGTAAACTGCGCCTGGAAACAGCTCCTAACATCAGCAAAGATGCTATTAGACA ACTTTTGCCCAAAGCTCCTCCACTCCGGGAACTGATTGATCAGTACGATGTCCAGAGAGATGACAGCAGTGATGGCTCTTTGGAAGATGATGATTACCACGCGACGACGGAAACAATCATTACC ATGCCTACAGAGTGTAAGTAGTCCTGTTAGTGTATATCAACAATTCTGCTGACTGTTGTTCTAGTGTTTATGAGAAACAGATCTATTTTCAGGCTCTTTTAACAAGCTGTTGGCTTGTATGTAAGC AGGAAGGAAAAGAGTTTCTTTTTTTCAAGATTTCATGAGAAATTTACTAATGAGACTGAAATCTGCTGCATTATTTGTTTTCTTAGAGAGCTAAAAAGCTAAACAAAATAAAATTCTTGCACAGC ATTAATATTATTTAGTTTAATATGACAAATATAACATGCTTATGCTTTCACAGCTTAATACCACCAAGGCAAAAATTGGGAGATAGTACAAGCAATGTTAAAAACTTACATGAGATTTCATAATT GCGTTTGGTTGCCTAAAATAAGCATTTATAATAACAAGTTTTTTTCACTAATAATAGAGAAGGAAGAAATTTGTAGACGTTTAGGTCATTTGAGCATTTGCTGAACACCAAAATGACTTCTGTTA CTCAAAACTATTTCTCATAGTGTTTTTATGTTCTTCACAAATTAACATATTAGATTTTGAAAGTTATTCCCCTGGAGATTAGGAAAAATATTTTTTAAAATTTAATGTATTAGTAAGAAAAATGAT GAAGTAAACATAGCATAATGATAATCATGAGCTAATTATCATAAAATGCCTAATAAATAAACATTTTAATCAAAGAGGTTATAGCTCAGAGTCCTGCTTACACCTTGACCATAGTACTATTGTTG AGAGCACCCGGGGTGCACATTTCCAGGCAGGCACATTGCTTAATAATCTCCTAAAATACAATTTTATTCTTCTTGGGAGGGAGGACTACTACCTGTAGTATCTATATTGCTTCTGAAAGATAATA TATTTCATATATTCTTTTTGCAGTCAGTTCATAACTACACTCAAGGAAAGGGAGACAGACACCTTCACAGAGAAGGCATGACACGGAAGATTCTGTGCCATGTGTCTGCGATCCTGCTTTACCCA GTGCTTTATCTACTTTAAACAGGACACAACAGTTTCAAAATATTGTTCTCCTTATTAAGTAATCAGGTTATAATGCACCAAATAATTTTCCTTTATGACTCTGCTATCAAATAGTCCTGGAGTAGAT TTACCTTATTTATAAACAATCTTGGGGAACCAAAATAAAAGAAATTGCTAGTGATTTTGCTCACAATGACAGCCTGGCTCTAAAGACAGTATTTTCTAACTTTTGAGATAGCCTGAATATAACAT TCAAATTTTTGTGCTAATTACTTGCTTAGCTTTGTTCCTTTAAAAGGCTATTCCAAAGCCAAAACATAACAGATGTACTATATTTTCTCTTAATTCCCGAGGCTCAGTTAGTTCCTCAGTGTGTCTTG TCCCCAGGTAATTCAGGCCTGGGGGAAGGGTTCCTTCTTCCAGACTGATTGGTACAGCTGCTCAGTAAGTGTAACTACTCAGATTCCCAAAGAATTCTAAGTGGATGTTCCTCCACGGTGTCTCT TGTTCTCTCTAATCATCATCATTTTAAAATTTCATCCACAGTTCATTCCTTCATAGAATTTTCCTTAGTTCACAGTTTTCTGGAAAAGAAGTAGATTCCTCATAAACAGCTGAAAAAACATATATCA AAAATTCTGAAAGGCTAGAGTAATTATATTCTTTGATATTTTTCTGAGTTATGAATGAAATTCTACATAGTTTTTCACTTTAAAAGACTAAATATATATTCAGTATTCCAATGGAAAAAAAATGTT CACCAACTAATATGGAAGGGTTTACTAATTTTTTATGATAAATAATTTCAATAACTCTTTTTCTTTTCTTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCT TTAAATTTAGCTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAACTGTGGATATATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAA AGACGGTACAAGGTATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAA CTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTTCCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATG TTTTTATTCATCATGTGAATGAATAATAGTGGAAAATCACTACCAGTTTCCTATGCTAACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTT CATATCCAATGAAACACCCTCTTGATATGTCAACTTTGCATGAGGATTAAAAAAACGTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCA TTGATATGCCACATAATTATATGAATAAAAACACAAAATCTTCACAATGGATTCTTGTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCT TAATAAAGCAGAGTAAAACTTTAAAAATTATAATTAAAATACAATGCTTTTATTTATAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAATATACCATATTCAAGGTCCCTCATGATA AATATGTTCATTATGTTCATTATTTTGCAGGCTGTTGATGCATTGATGTTTCTGTAGATTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAG CTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAACTGTGGATATATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACA AGGTATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATT GAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTTCCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCA TCATGTGAATGAATAATAGTGGAAAATCACTACCAGTTTCCTATGCTAACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAAT GAAACACCCTCTTGATATGTCAACTTTGCATGAGGATTAAAAAAACGTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCC ACATAATTATATGAATAAAAACACAAAATCTTCACAATGGATTCTTGTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCA GAGTAAAACTTTAAAAATTATAATTAAAATACAATGCTTTTATTTATAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAATATACCATATTCAAGGTCCCTCATGATAAATATGTTCA TTATGTTCATTATTTTGCAGGCTGTTGATGCATTGATGTTTCTGTAGATTATTCATTTATAGCTGATCTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAGCTCTAAAATA CAATACAATAAAGTAGTAAAGGCCCAACTGTGGATATATCTGAGACCCGTCAAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTG GAATCCGATCTCTGAAACTTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAG CTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTTCCCAAGACCAGGAGAAGATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCATCATGTGAATG AATAATAGTGGAAAATCACTACCAGTTTCCTATGCTAACAAGCTAGACAAAGGCATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAATGAAACACCCTC TTGATATGTCAACTTTGCATGAGGATTAAAAAAACGTTATACCATAGTCCTTAACTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCCACATAATTATA TGAATAAAAACACAAAATCTTCACAATGGATTCTTGTACATACCCAACAAATTAAACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCAGAGTAAAACT TTAAAAATTATAATTAAAATACAATGCTTTTATTTATAGCAATTAAGTACAAAATGTTTAGGCTTATATTTTATTAAAATCTCTGAAACTTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCA TTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTTCCCAAGACCAGGAGAAG ATGGGCTGGTAAGTGATAAATGAAAATAATATTCTAACAACCTTGTTATGTTTTTATTCATCATGTGAATGAATAATAGTGGAAAATCACTACCAGTTTCCTATGCTAACAAGCTAGACAAAGG CATCTTACCCCAATGGCAGCCCTGTACCCAATAAAAGTAGGTGTCCAATTTCATATCCAATGAAACACCCTCTTGATATGTCAACTTTGCATGAGGATTAAAAAAACGTTATACCATAGTCCTTAA CTCCTCAGGGAGTTCTTTGGAATTGGGAATGAAATATAAAGTGCTTTTCATTGATATGCCACATAATTATATGAATAAAAACACAAAATCTTCACAATGGATTCTTGTACATACCCAACAAATTA AACCTTTTCTTCCCCCCAGAAGAGTGTCAAATGTGTTGAAAGTTTTCTGCTTAATAAAGCAGAGTAAAACTTTAAAAATTATAATTAAAATACAATGCTTTTATTTATAGCAATTAAGTACAAAAT GTTTAGGCTTATATTTTATTAAATATACCATATTCAAGGTCCCTCATGATAAATATGTTCATTATGTTCATTATTTTGCAGGCTGTTGATGCATTGATGTTTCTGTAGATTATTCATTTATAGCTGAT CTTCTAATGCAAGTGGAAGGAAAACCCAAATGTTGCTTCTTTAAATTTAGCTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAACTGTGGATATATCTGAGACCCGTCAAGACTCCTACAA CAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCGCTGGTATTTGGCAGAGCATTGATGTGA AGACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACCTTCCCAAGACCAGGAGA

5 Completed in January 2007 Collaborative effort among scientists 1 female Thoroughbred The principal goal of the Horse Genome Project is to benefit the health and welfare of horses Twilight Science 6 November 2009: Vol. 326. no. 5954, pp. 865 - 867 The horse genome project

6 The Horse Genome was sequenced at The Broad Institute, MIT & Harvard, Boston

7 DNA is the genetic material that spells out the genetic code DNA is made up of the letters G A T C Approx. 3 billion letters spell out the genetic code Genetic material is arranged in 32 pairs of chromosomes A chromosome is a long linear DNA molecule with 1000s of genes. The genetic code AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGACAAGCCCTGTCATATGATCGTTCCAGAGATATTT

8 Simple trait Complex trait Genes are found across a chromosome like ‘beads on a string’ There are approx. 25,000 genes in the genome Genes contain the ‘recipe’ for proteins Proteins are expressed in the cell and are responsible for the physical expression of the trait

9 Genotype = The actual genetic make up of an individual Phenotype = The observed characteristics of an individual Genotype (genetic composition) Genotype + Environment = Phenotype Phenotype Actions of other genes and their products Environmental influences

10 How important are genes? Definition of a Thoroughbred relates to its genetic heritage Pedigrees are visual representation of the ancestral genetic contributions to an individual Provide some indication of the possible genetic make-up

11 Genes and performance Ability to perform on the racetrack requires the right combination of genes and a favourable environment In humans > 200 genes for health and fitness related traits have been characterised Likely that a large number of genes contribute to performance in an additive way

12 What’s the difference? Studies have shown 35 – 55 % variation in racetrack performance is heritable When all other things are equal, the genetic make-up of an individual will almost entirely be responsible for the variation in the phenotype. The difference between two individuals is the difference in the spelling of the genetic code.

13 Population genomics & selectionFunctional genomics of exercise SNP association & racing performanceExercise physiology

14 The Speed Gene - myostatin Investigated DNA differences in the myostatin gene in Thoroughbreds Myostatin is a gene responsible for muscle mass development DNA differences in myostatin are responsible for muscle hypertrophy phenotypes in cattle, sheep, dogs, mice and humans

15 The difference in the DNA Identified a single DNA difference in the genetic code of myostatin AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGA C AAGCCCTGTCATATGATCGTTCCAGAGATATTT AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGA T AAGCCCTGTCATATGATCGTTCCAGAGATATTT C  T

16 Pair of chromosomes Gene Variant C Gene Variant T Paternal origin (sire) Maternal origin (dam) AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGACAAGCCCTGTCATATGATCGTTCCAGAGATATTT AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGATAAGCCCTGTCATATGATCGTTCCAGAGATATTT CT

17 Pair of chromosomes Gene Variant C Paternal origin (sire) Maternal origin (dam) AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGACAAGCCCTGTCATATGATCGTTCCAGAGATATTT AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGATAAGCCCTGTCATATGATCGTTCCAGAGATATTT CC

18 Pair of chromosomes Gene Variant T Paternal origin (sire) Maternal origin (dam) AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGACAAGCCCTGTCATATGATCGTTCCAGAGATATTT AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGATAAGCCCTGTCATATGATCGTTCCAGAGATATTT TT

19 Pair of chromosomes Paternal origin (sire) Maternal origin (dam) AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGACAAGCCCTGTCATATGATCGTTCCAGAGATATTT AGTCTTGACTGATATCTTGTCTATAGTGATTCTAGATAAGCCCTGTCATATGATCGTTCCAGAGATATTT CCCTTT

20 A test for Class? Investigated the frequency of the C:C – types, C:T – types and T:T – types in 148 unrelated Thoroughbreds No difference between Group race winners and non-winners

21 Best race distance Best race distance (BRD)  distance of the highest grade of race won. Highly statistically significant (P = 4.85 x 10 -8 ) association with BRD and genetic type when Group race winners were separated into short and long distance winners. The three genetic types were strongly associated with best race distance: C:C – short-distance C:T – middle-distance T:T – middle/long-distance

22

23 nGr1Gr2Gr3L 17980254628 n5 - 6f7 - 8f9 - 10f11 - 12f> 13f 179386235377 179 Group and Listed race winners

24 furlongs Average Best Race Distance

25 furlongs

26

27

28 3-year-old race distances furlongs

29 What is a C:C ? Average best race distance – 6.5 f 75 % 5 f winners are C:C 65 % 6 f winners are C:C 98 % of C:Cs win ≤ 8 f FAST, SPEEDY, SPRINT TYPE ≤ 8 f

30 What is a C:T ? Average best race distance – 9.1 f Almost 70 % C:Ts win ≥ 8 - 12 f 50 % C:Ts win ≤ 8 f 55 % of 12 f winners are C:T FAST, MIDDLE-DISTANCE TYPE 7 – 12 f

31 What is a T:T ? Average best race distance – 11.1 f > 90 % T:Ts win ≥ 8 f > 80 % T:Ts win ≥ 10 f No 5 f or 6 f winners are T:T EXHIBITS STAMINA > 8 f

32 Optimum genetic profile for distance furlongs

33 Quarter Horse – speed

34 Egyptian Arabian – stamina

35 Thoroughbred (Flat) – speed & stamina

36 There were no C:Cs among 32 NH winners in a prominent Irish NH yard Thoroughbred (National Hunt) – stamina

37 Practical Applications 1. Young stock (foals and yearlings) Make informed selection and sales decisions 2. Horses-in-training Reduce operating costs and fine-tune racing strategy 3. Broodmares Optimise breeding outcomes 4. Stallions Promote stallions potential

38 Young stock (foals and yearlings) Make informed selection and sales decisions Establish achievement of breeding goal Identify speedy individuals and early two-year-olds Identify middle-distance individuals with speed Identify longer distance individuals with enhanced stamina

39

40

41

42 TT C TTT CT TT CT

43 TT T TTT TT TT TT

44 CT C TCT CT TT CC This is an example only

45 CC C TCT CC CT CC

46 CC C CCC CC CC CC

47 Horses-in-training Reduce operating costs and fine-tune racing strategy identify most precocious two-year olds train and race for optimal racing distance

48 nno. runners total no. races won % winners to runners % wins to runners mean no. races per runner total earnings (£) mean earnings (£) no. earners > £100k CC40211752.481.04.1511k20k1 CT67322656.381.33.61801k36k5 TT3513646.2 3.187k5k0 n = 142 two-year-olds in training with same trainer 2007 & 2008 As two-year olds C:C and C:T horses outperform T:T horses C:C and C:T horses earn up to 13-times more than T:T horses as two-year- olds C:C two-year-old colts have 7% more muscle mass than T:T two-year-old colts nno. runners total no. races won % winners to runners % wins to runners mean no. races per runner total earnings (£) mean earnings (£) no. earners > £100k CT22121875.0150.03.81620k73k6 TT199555.6 2.667k3k0 n = 41 two-year-olds in training with same trainer 2007 & 2008 by a single sire

49 Broodmares Optimise breeding outcomes focus on optimal breeding mares select compatible stallions mix and match mares and stallions to fine-tune breeding goals

50 MatingProgeny C:C on C:C100 % C:C C:T on C:C50% C:C 50 % C:T T:T on C:C100 % C:T C:T on C:T25 % C:C 50 % C:T 25 % T:T C:T on T:T50 % C:T 50 % T:T T:T on T:T100% T:T Mix and match matings to suit breeding goal

51 Stallions Promote stallion potential predict stamina index for young stallions (5 year advantage) attract compatible mares to enhance stallion profile Stallion Stamina Index

52 Who can use the Equinome Speed Gene Test? Bloodstock agents Owners Commercial breeders Owner/breeders Trainers Pin-hookers The Equinome Speed Gene Test is available in Ireland and is also available to the global bloodstock industry

53 What are the benefits of the Equinome Speed Gene Test? Reduce risk Minimize operating costs Maximize return on investment Improve strike rate

54 Sample Submission Provide 4-5 ml uncoaggulated blood sample (purple cap K2-EDTA tube) per horse Clearly label tube Complete Sample Submission Form Results returned within 3 weeks of receipt of sample EQUINOME Laboratories UCD Veterinary Sciences Centre University College Dublin Belfield, Dublin 4 Ireland. tel: +353 (0)1 716 3775 www.equinome.com

55 Thanks to... UCD School of Agriculture, Food Science and Veterinary Medicine NovaUCD Innovation and Technology Transfer Centre Science Foundation Ireland Glebe House office and yard staff Irish Thoroughbred Breeders’ Association Owners, breeders and trainers for willingly and generously providing the crucial samples for the research project.

56 "The introduction of genetic know-how to breeding will dramatically change the face of the bloodstock industry. We have begun and intend to continue to utilise this highly valuable tool to fine-tune decision making in our operation. This will fundamentally change the way we will have to think about breeding in the future.“ John O'Connor MRCVS, Managing Director, Ballylinch Stud, Ireland "I found your findings fascinating, and highly credible in that they tally with what we have learnt during many years practical experience. Having this information available before the event is sure to provide users with an edge.“ Kirsten Rausing, Chairman, The Thoroughbred Breeders' Association (Great Britain)

57 www.equinome.com


Download ppt "Cracking the code: The Speed Gene Revealed Dr. Emmeline Hill Equinome Ltd., NovaUCD, Belfield Innovation Park, Belfield, Dublin 4"

Similar presentations


Ads by Google