Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription and Translation (How a Gene Works) Alison Kraigsley January 18 th, 2011.

Similar presentations


Presentation on theme: "Transcription and Translation (How a Gene Works) Alison Kraigsley January 18 th, 2011."— Presentation transcript:

1 Transcription and Translation (How a Gene Works) Alison Kraigsley January 18 th, 2011

2 Overview 1.Brief Introduction 2.My background 3.Research at NIST 4.Today’s experiment

3 Overview 1.Brief Introduction 2.My background 3.Research at NIST 4.Today’s experiment

4 From DNA to People DNA is your genetic blueprint Too valuable to risk damaging mRNA (messenger RNA) used to transfer the genetic code into protein (specific trait) – DNA codes for hair colour – Protein is the actual hair with colour DNA mRNA Protein TranscriptionTranslation

5 From DNA to People DNA is DNA = same for all living things Genetic code is different – 20,000-25,000 genes in humans (99.5% similar) – 32,000 -56,000 genes in rice (Oryza sativa) – 19,000 genes in earth worm (Caenorhabditis elegans), – 25,000 gene in a plant (Arabidopsis thaliana ) DNA mRNA Protein TranscriptionTranslation

6 Green Fluorescent Protein (GFP) Revolutionized biology GFP tagged genes, cells, proteins Can tell where/when/how biology is happening – But what is it exactly?

7 Green Fluorescent Protein (GFP) GFP comes from the Jellyfish Aequorea victoria. The gene was cloned (copied) and transferred to other organisms 2008 Nobel Prize in Chemistry

8 GFP Stem Cells Inner glow. Transplanted motor neurons (green) spread out from the spinal cord of an embryonic chick. http://cmbi.bjmu.edu.cn/news/0208/44.htmhttp://cmbi.bjmu.edu.cn/news/0208/44.htm, Wichterle et al., Directed Differentiation of Embryonic Stem Cells into Motor Neurons, Cell, 2002, 110, 385-397

9 GFP Reporter GFP reporter gene expression in central nervous system neurons that innervate the hindgut of Drosophila melanogaster http://www.neuroscience.cam.ac.uk/directory/profile.php?gal26

10 GFP Reporter Spliced the right way, fru establishes a “courtship” circuit of neurons (green) in the male fly brain. http://www.sciencemag.org/content/308/5727/1392.full

11 Overview 1.Brief Introduction 2.My background 3.Research at NIST 4.Today’s experiment

12 ME!! Education – B.Sc. Chemistry/Physic: Furman University, Greenville SC – M.S. Aerospace Engineering: University of Southern California, Los Angeles CA – Ph.D. Molecular Biology: University of Southern California, Los Angeles CA Research – M.S. : Polymers – Ph.D: Biofilms, evolution – NIST: Biofilm-material interactions

13 PhD Work: Biofilm Life Cycle Modified from O’Toole et al., 2000

14 What about long term? What happens when a biofilm is present for long periods of time Can we observe evolutionary change in a biofilm? – Does some kind of GASP-like phenotype occur in biofilms?

15 The GASP Phenotype Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. Growth Advantage in Stationary Phase. Log CFU/mL Finkel and Kolter, 1999

16 The GASP Phenotype Aged cells outcompete younger, initially isogenic cells when mixed. Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. To date, all experiments performed on planktonic cells or in stab cultures. Growth Advantage in Stationary Phase. Growth Advantage in Stationary Phase. Log CFU/mL Finkel and Kolter, 1999 Biofilm GASP?

17 Competition-Invasion Assay Day 1= 12 of 23 trials significant in favour of 22-day-old cells Day 2= 21 of 24 trials significant in favour of 22-day-old cells Box indicates titer error of  3 fold

18 Overview 1.Brief Introduction 2.My background 3.Research at NIST 4.Today’s experiment

19 NIST Research How do biofilms respond to their substrate? Modified from O’Toole et al., 2000 Does substrate matter?

20 Results: Decrease in Metabolic Activity at Low DC Decrease in metabolic activity between 4 and 24 hrs Greater decrease at 24 hrs on low DC polymers Unpublished dad

21 Live/Dead- Confocal 24hr UV treated

22 Overview 1.Brief Introduction 2.My background 3.Research at NIST 4.Today’s experiment

23 pGlo: GFP plasmid pGlo is a plasmid – Circular DNA – Can be transformed into bacteria – Independently replicating pGlo has Ampicillin Resistance GFP on the plasmid is inducible by arabinose

24 Transformation Def: inserting a plasmid into a bacterial cell Two methods – Heat Shock – Electroporation Mechanism unknown Bacteria must have a reason to keep the plasmids (ex. Drug resistance = benefit)

25 Genes at work pGlo DNA is NOT fluorescent Only when the plasmid is transformed into the bacteria can fluorescence be observed – Bacteria’s cellular machinery takes the DNA coding for GFP, makes mRNA, then the Green Fluorescent Protein. The GENE is NOT fluorescent, the PROTEIN IS fluorescent. DNA mRNA Protein TranscriptionTranslation

26 Inducible Gene Expression When you want total control Turn genes on or off with an external control (ex. Arabinose) – Arabinose is a sugar GFP is under the control of a tightly regulated system on the plasmid. GFP will only be turned on when arabinose is present.

27 Procedure Walk through general procedure The full manual has a lot of good information and discussion points

28 Results

29 No growthLawn of cells AmpR = Cells have plasmid Positive Control Negative Control Have GFP gene, but not turned on

30 Plasmid sequence with GFP 5- AGATTGCAGCATTACACGTCTTGAGCGATTGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATT TAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACC TGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATC AAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACAT CTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGG GTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGAT AAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCA AAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTC AAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCT TCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAA CTTCGGAATAGGAACTAAGGAGGATATTCATATGGTAAGTTACTGAAGAATTCGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCCGGGTACCT AGAATTAAAGAGGAGAAATTAAGCGCTCATATGCGGAATTCGCTAGTTCTCATATGGACCATGGCTAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCA CTGAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATAT ATTCTTTTTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACA TGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGT ACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCGGATCTTGCGGCCGCAAAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT ATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGT CGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAA ACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCG CCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCAT GGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTA TGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGG CGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAA GCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA CCTGCATCGATGGCCCCCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGG GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTG GCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTGGCCAGTGCCAAGCTTGCATGC


Download ppt "Transcription and Translation (How a Gene Works) Alison Kraigsley January 18 th, 2011."

Similar presentations


Ads by Google