Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription and Translation (How a Gene Works)

Similar presentations


Presentation on theme: "Transcription and Translation (How a Gene Works)"— Presentation transcript:

1 Transcription and Translation (How a Gene Works)
Alison Kraigsley January 18th, 2011

2 Overview Brief Introduction My background Research at NIST
Today’s experiment

3 Overview Brief Introduction My background Research at NIST
Today’s experiment

4 From DNA to People DNA is your genetic blueprint
Too valuable to risk damaging mRNA (messenger RNA) used to transfer the genetic code into protein (specific trait) DNA codes for hair colour Protein is the actual hair with colour DNA mRNA Protein Transcription Translation

5 From DNA to People DNA is DNA = same for all living things
Genetic code is different 20,000-25,000 genes in humans (99.5% similar) 32, ,000 genes in rice (Oryza sativa) 19,000 genes in earth worm (Caenorhabditis elegans), 25,000 gene in a plant (Arabidopsis thaliana ) DNA mRNA Protein Transcription Translation

6 Green Fluorescent Protein (GFP)
Revolutionized biology GFP tagged genes, cells, proteins Can tell where/when/how biology is happening But what is it exactly?

7 Green Fluorescent Protein (GFP)
GFP comes from the Jellyfish Aequorea victoria. The gene was cloned (copied) and transferred to other organisms 2008 Nobel Prize in Chemistry

8 GFP Stem Cells Inner glow. Transplanted motor neurons (green) spread out from the spinal cord of an embryonic chick. Wichterle et al., Directed Differentiation of Embryonic Stem Cells into Motor Neurons, Cell, 2002, 110,

9 GFP Reporter GFP reporter gene expression in central nervous system neurons that innervate the hindgut of Drosophila melanogaster

10 GFP Reporter Spliced the right way, fru establishes a “courtship” circuit of neurons (green) in the male fly brain.

11 Overview Brief Introduction My background Research at NIST
Today’s experiment

12 ME!! Education B.Sc. Chemistry/Physic: Furman University, Greenville SC M.S. Aerospace Engineering: University of Southern California, Los Angeles CA Ph.D. Molecular Biology: University of Southern California, Los Angeles CA Research M.S. : Polymers Ph.D: Biofilms, evolution NIST: Biofilm-material interactions

13 PhD Work: Biofilm Life Cycle
Modified from O’Toole et al., 2000

14 What about long term? What happens when a biofilm is present for long periods of time Can we observe evolutionary change in a biofilm? Does some kind of GASP-like phenotype occur in biofilms?

15 The GASP Phenotype Growth Advantage in Stationary Phase.
Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. Log CFU/mL Finkel and Kolter, 1999

16 The GASP Phenotype Growth Advantage in Stationary Phase. Biofilm GASP?
Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. Log CFU/mL Biofilm GASP? Finkel and Kolter, 1999

17 Competition-Invasion Assay
Day 1= 12 of 23 trials significant in favour of 22-day-old cells Day 2= 21 of 24 trials significant in favour of 22-day-old cells Box indicates titer error of  3 fold

18 Overview Brief Introduction My background Research at NIST
Today’s experiment

19 NIST Research How do biofilms respond to their substrate?
Modified from O’Toole et al., 2000 Does substrate matter?

20 Results: Decrease in Metabolic Activity at Low DC
Decrease in metabolic activity between 4 and 24 hrs Greater decrease at 24 hrs on low DC polymers Unpublished dad

21 Live/Dead- Confocal 24hr
UV treated

22 Overview Brief Introduction My background Research at NIST
Today’s experiment

23 pGlo: GFP plasmid pGlo is a plasmid pGlo has Ampicillin Resistance
Circular DNA Can be transformed into bacteria Independently replicating pGlo has Ampicillin Resistance GFP on the plasmid is inducible by arabinose

24 Transformation Def: inserting a plasmid into a bacterial cell
Two methods Heat Shock Electroporation Mechanism unknown Bacteria must have a reason to keep the plasmids (ex. Drug resistance = benefit)

25 Genes at work pGlo DNA is NOT fluorescent
Only when the plasmid is transformed into the bacteria can fluorescence be observed Bacteria’s cellular machinery takes the DNA coding for GFP, makes mRNA, then the Green Fluorescent Protein. The GENE is NOT fluorescent, the PROTEIN IS fluorescent. DNA mRNA Protein Transcription Translation

26 Inducible Gene Expression
When you want total control Turn genes on or off with an external control (ex. Arabinose) Arabinose is a sugar GFP is under the control of a tightly regulated system on the plasmid. GFP will only be turned on when arabinose is present.

27 Procedure Walk through general procedure
The full manual has a lot of good information and discussion points

28 Results

29 Results No growth Lawn of cells AmpR = Cells have plasmid
Have GFP gene, but not turned on Negative Control Positive Control

30 Plasmid sequence with GFP
5-AGATTGCAGCATTACACGTCTTGAGCGATTGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGTAAGTTACTGAAGAATTCGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCCGGGTACCTAGAATTAAAGAGGAGAAATTAAGCGCTCATATGCGGAATTCGCTAGTTCTCATATGGACCATGGCTAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTGAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCGGATCTTGCGGCCGCAAAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGCATCGATGGCCCCCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTGGCCAGTGCCAAGCTTGCATGC


Download ppt "Transcription and Translation (How a Gene Works)"

Similar presentations


Ads by Google