Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplemental data A dual positional specific lipoxygenase functions in the generation of flavour compounds during climacteric ripening of apple Schiller.

Similar presentations


Presentation on theme: "Supplemental data A dual positional specific lipoxygenase functions in the generation of flavour compounds during climacteric ripening of apple Schiller."— Presentation transcript:

1 Supplemental data A dual positional specific lipoxygenase functions in the generation of flavour compounds during climacteric ripening of apple Schiller D, Contreras C, Vogt J, Dunemann F, Defilippi B, Beaudry R, and Schwab W Figures S1 – S9 Figure S1Sequence similarity of apple LOX genes Figure S2Comparison of the deduced amino acid sequences of five apple LOX genes. Figure S3RT-PCR expression of LOX transcripts Figure S4SDS-PAGE of purified recombinant apple LOX proteins. Figure S5Effects of temperature and pH on the enzymatic activity of apple LOX enzymes. Figure S6LC-MS analysis of hydroperoxy fatty acids (HpODE) formed from linoleic acid catalyzed by LOX1:Md:1a (A) and LOX1:Md:1c (B). Figure S7Effect of substrate concentration on enzymatic activity of wild-type and mutant apple LOX. Figure S8Transient expression of select LOX genes Figure S9 Factors that determine regio- and stereospecificity of LOX1:Md:1a Figure S10 Characterization of ripening apple fruit.

2 Tables S1 – S6 Table S1Identity of Malus x domestica lipoxygenases, and oligonucleotides used for gene amplification. Table S2Locus, description, forward and reverse primer sequence (5→3'), annealing temperature, expected PCR fragment size, and optimum RT-PCR cycle number for putative LOX gene expression in skin tissue from ripening 'Jonagold' fruit. Table S3Locus, description, and forward and reverse primer sequences (5→3') for qPCR amplification of selected LOX genes and a GAPDH control gene in skin tissue from ripening 'Jonagold' fruit. Table S4Distribution of hydro(pero)xy products gained from wild-type and mutant apple LOX enzyme reaction with α-linolenic acid and arachidonic acid. Table S5Oligonucleotides used to amplify the MdLOX1a, MdLOX1c, MdLOX2a and MdLOX2b genes for subcloning into pRSET B and pYES2 expression vectors. Table S6Oligonucleotides used for site-directed mutagenesis of the MdLOX1a gene.

3 Figure S1 Sequence similarity of apple LOX genes. Nucleotide sequences of the GenBank accessions KC and KC were compared to the coding sequence of PdLOX1 (AJ404331), CaLOX1 (AJ417975) and VvLOXO (FJ858257). Values (in %) depicting high similarity are shaded in light grey (60-80% similar) or dark grey (80-100% similar).

4

5 Figure S2 Comparison of the deduced amino acid sequences of five apple LOX genes. Protein sequences of the MdLOX1a, MdLOX1c, MdLOX1d, MdLOX2a and MdLOX2b genes were aligned using the Muscle software. The sequence domain involved in substrate binding is highlighted with a dashed line. The highly conserved C-terminal motif is underlined with a continuous line. Presumed amino acid residues responsible for regio- and stereospecificity of plant LOXs are denoted by a white and a black rhomb, respectively. Amino acids marked with a triangle participate in the coordination of the catalytic iron atom into the enzyme active site. An asterisk designates the highly conserved arginine residue, which is common for all plant LOXs, and is essential for enzyme activity. Sequence positions that were chosen for site-directed mutagenesis in MdLOX1a are indicated by arrows.

6 Figure S3 RT-PCR expression screening of LOX transcripts. RT-PCR analysis of LOX gene expression for ‘Jonagold’ apple fruit during ripening. Eight time points were selected based on distinct physiological stages (see Fig. 2). Total RNA was isolated from fruit at each time point and GAPDH (lower right-hand panel) was used as a control.

7 Figure S4 SDS-PAGE of purified recombinant apple LOX proteins. Lanes correspond to crude extracts obtained from yeast cells carrying expression constructs for LOX1:Md:1a (1), LOX1:Md:1c (3), LOX2:Md:2a (5), LOX2:Md:2b (7) and empty pYES2 vector (9). A 10% acrylamide gel was loaded with 30 µg crude extract and 5 µg IMAC-treated protein each and stained with Coomassie. Partially purified LOX protein is marked with a red frame (Lanes 2, 4, 6 and 8). In contrast, IMAC-treated protein from extracts with empty pYES2 vector contained no distinct protein band of approximately 100 kDa size (10). LOX2:Md:2a LOX1:Md:1c LOX1:Md:1a LOX2:Md:2bpYES2 130 kDa → 70 kDa → 55 kDa → 35 kDa → 25 kDa → 250 kDa → 100 kDa →

8 temperature, °CpH relative activity, % LOX1:Md:1a LOX1:Md:1c LOX2:Md:2a LOX2:Md:2b Figure S5 Effects of temperature and pH on the enzymatic activity of apple LOX enzymes. LOX activity rates of recombinant LOX1:Md:1a (A, E), LOX1:Md:1c (B, F), LOX2:Md:2a (C, G) and LOX2:Md:2b (D, H) with linoleic acid were assayed at variable temperatures and pH values. The optimal reaction temperature for each enzyme was determined at 5 to 55°C and a pH of 7 (A-D). For determination of pH optimum, the reaction was run across a pH range of 3 to 10 at 25°C in the following buffers: sodium citrate for pH 3 to 6 (white squares), sodium phosphate for pH 6 to 8 (grey squares), and Tris-HCl for pH 8 to 10 (black squares), respectively (E-H). Values are the means ±SD for at least three independent measurements.

9 Figure S6 LC-MS analysis of hydroperoxy fatty acids (HpODE) formed from linoleic acid catalyzed by LOX1:Md:1a (A) and LOX1:Md:1c (B). Residual linoleic acid was monitored at m/z 279 [C 18 H 32 O 2 -H] -. The formation of HpODE was monitored at m/z 293 [C 18 H 32 O 4 -H 2 O-H] - (-MS top and bottom). Presence of 13- HpODE is confirmed by the fragment ions m/z 195 and 113 (-MS2(293) top) while fragment ions m/z 185 and 125 are indicative of 9-HpODE (-MS2(293) bottom).

10 Figure S7 Effect of substrate concentration on enzymatic activity of wild-type and mutant apple LOX. LOX activity rates of recombinant LOX1:Md:1a (A) and LOX1:Md:1c (B) as well as mutant Gly567Ala protein (C) were monitored across a range of concentrations (2.5 to 100 µM) of linoleic acid (LA) and α-linolenic acid (LnA). The data were then fitted using Michaelis-Menten equation to calculate kinetic characteristics K m and V max. [S], µM Rate, µmol min -1 mg -1 A Wild-type LOX1:Md:1a [S], µM Rate, µmol min -1 mg -1 B [S], µM Rate, µmol min -1 mg -1 C Wild-type LOX1:Md:1c Mutant Gly567Ala protein

11 Figure S8 Transient expression of selected LOX genes. Transient expression of MdLOX7a, MdLOX7c, and MdLOX1a (A, annotated as 9-LOX, 40µm ruler) and MdLOX2a, MdLOX4a, and MdLOX6b (B, annotated as 13-LOX, 30, 20, and 5 µm ruler, respectively) in tobacco leaves after three days by confocal microscopy as described by Brandizzi et al. (2002). The left column shows chloroplast autofluorescence, the middle column shows the protein fused with YFP, and the right column shows the overlay image.

12 Factors that determine regio- and stereospecificity of LOX1:Md:1a Until now there is no comprehensive theory which illustrates all mechanisms underlying positional specificity of plant LOXs (Feussner and Wasternack, 2002). In principal, it is often explained by a combination of factors, such as depth of substrate binding pocket (Gillmor et al., 1997) as well as substrate orientation (Gardner, 1989). Fatty acid substrates presumably enter the hydrophobic environment of the enzyme active site with their methyl end first. The site of substrate oxygenation is then determined by the depth of the substrate-binding pocket. In 13-LOXs this space is usually limited due to bulky amino acids (histidine or phenylalanine) in the so-called Sloane position (Sloane et al., 1995). In contrast, 9-LOX harbour smaller amino acids (e.g., valine), which allows the substrate to enter deeper into the binding pocket. For plant LOXs, a second theory has been proposed, where the site of dioxygenation is determined by the accessibility of a conserved arginine residue at the bottom of the pocket (Hornung et al., 1999). In the case of 13-LOX, the arginine residue is shielded by space-filling amino acids in the Sloane position. However, in 9-LOX the positively charged residue is accessible and allows the substrate to enter in an inverse head-to-tail orientation favouring a penetration with its carboxylic group first. In the case of LOX1:Md:1a, fatty acid substrates are most likely penetrating the active site with their carboxyl end first, as it was proposed by Boeglin et al. (2008). Given that the enzyme harbours a valine residue (Val582) in the Sloane position, the carboxyl group of the substrate is supposed to form a salt bridge with the conserved Arg732 residue at the bottom of the pocket (Figure 5). This might explain why mutation of Arg268 near the entry site had no effect on enantiomeric composition and regiochemistry of hydroperoxides gained from reaction with all tested fatty acids. However, attempts to alter LOX1:Md:1a specificity in favour of a 13(S)-LOX activity failed. The Val582Phe mutant, which should result in a straight substrate orientation, still produced considerably high amounts of 13(R)-HpODE from LA and small amounts of 9-HpODE consisting of a racemic mixture of enantiomers. In general, substitution of a small residue in the Sloane position with a histidine or phenylalanine is able to convert linoleate 9-LOX or dual-positional specific LOX to pure 13-LOX and vice versa (Hornung et al., 1999; Hornung et al., 2008). However, in some cases bulkiness of this residue is not the sole determinant of positional specificity (Hughes et al., 2001). The unchanged stereochemistry of 13-hydroperoxides produced by Val582Phe indicated that fatty acid substrates were still able to enter the enzyme active site in inverse orientation. The bulky phenylalanine could, however perturb the oxygenation at C9-position sterically leading to the unspecific formation of 9-hydroperoxides. The major influence of a single active site amino acid on LOX stereospecificity has only recently been described by Coffa and Brash (2004). The so-called Coffa site is conserved as an alanine in (S)- and a glycine in (R)-LOX. Evidence for this theory has been provided by mutagenesis of the alanine residue in wild-type (S)-LOX to glycine, leading to mutant (R)-LOX with dual positional specificity (Coffa et al., 2005; Boeglin et al., 2008). In LOX1:Md:1a, mutation of the wild-type Gly567 residue to alanine changed the dual positional (R)-LOX to an 9(S)-LOX with a product formation similar to LOX1:Md:1c for all three tested substrates (Table 2; supplementary data Table S4). Additionally, the alanine substitution yielded a 10-fold and 8.5-fold increase in catalytic efficiency of LA- and LnA-hydroperoxidation, respectively (Table 4). This is in accordance to an earlier report on a 6-fold drop in LA turnover caused by the substitution of alanine by glycine in the Coffa site of soybean LOX-1 (Coffa et al., 2005). The volume of the side chains in this position might not only have effects on the oxygen access to the activated pentadienyl radical, but also change the way the substrate interacts with the catalytic iron center (Coffa et al., 2005). In general, stereochemical control of LOX activity is thought to involve a switch in the position of oxygenation on the substrate (Coffa and Brash, 2004). A glycine promotes oxygenation near the catalytic iron atom resulting in (R)-stereochemistry. Whereas the larger alanine residue allows oxygenation only deep in the active site cavity and gives (S)-hydroperoxides. An inversion of substrate orientation is therefore not essentially required to produce 9- and 13-hydroperoxides from LA with the same enzyme. In addition, a model for steric control of LOX activity was proposed in which oxygen is directed to a specific site of the substrate via a postulated side channel (Knapp et al., 2001). In LOX1:Md:1a, three residues (Leu521, Leu572, Ile578) border this channel where it should intersect the substrate cavity. We found that Ile578 aligns with a isoleucine residue discussed to determine O 2 availability in soybean LOX-1 (Knapp et al., 2001; Ivanov et al., 2010). Mutation of the corresponding Ile553 in the soybean LOX to a bulky phenylalanine residue seemed to constrict the putative oxygen binding channel leading to a drastic decrease in catalytic efficiency (Knapp and Klinman, 2003). Although, mutation of Ile578 to leucine had nearly no effects on LOX1:Md:1a activity, recombinant Ile578Leu protein lost some of its regiospecificity producing more 9-hydroperoxides from LA and LnA (Table 2, supplementary data Table S4). In contrast, mutation of Leu572 to isoleucine seemed to strongly impede oxygen access to the substrate binding cavity leading to an almost complete loss of enzymatic activity. Considering the idea that Ile578 might be involved in sterically directing oxygen to the substrate in favour of the C13 position of LA and LnA, the mutation to leucine might enable oxygen a better access to the C9 position farther down the pocket. Furthermore, we found that Ile578Leu promoted oxygenation at the C9- and C5-position of AA (supplementary data Table S4). Based on a model predicting inverse orientation of AA substrate in the active site, this is also consistent with our earlier conclusion. Product specificity of LOX1:Md:1a can therefore be explained as a combination of the following factors: i) A valine residue (Val582) in the Sloane position allows fatty acid substrates to penetrate the active site in inverse head-to-tail orientation. ii) A glycine residue (Gly567) in the Coffa site sterically enables oxygenation at both C9 and C13 position in the carbon chain of LA. iii) The shape of the substrate binding pocket, including a proposed oxygen channel, favours oxygenation at C13 over C9, thereby determining product proportions. The amino acid composition of the entrance site has an important influence on substrate affinity and catalytic efficiency of LOX as well (Knapp and Klinman, 2003; Coffa et al., 2005; Palmieri-Thiers et al., 2011). It was demonstrated that penetration of fatty acid substrates into the active site of olive LOX1 requires the movement of the side chains of Phe277 and Tyr280 (Palmieri-Thiers et al., 2011). Both sequence positions are highly conserved among plant LOX (LOX1:Md:1a: Phe277, Tyr280). Thus, it can be assumed that mutagenesis of the nearby Ile566 (Figure 5) to a more space-filling amino acid would also affect enzyme activity. Indeed, LOX activity of the Ile566Phe mutant was nearly completely abolished. The Ile566 residue is bordering the entry to the substrate binding pocket and is located in helix 11 together with conserved residues, which have been shown to influence kinetic efficiency and regiospecificity of LOX (Coffa et al., 2005). It appears, that replacement of this residue with a phenylalanine entailed a constriction of the substrate channel leading to perturbed accessibility of the binding pocket. Figure S9 Factors that determine regio- and stereospecificity of LOX1:Md:1a.

13 Figure S10 Characterization of ripening apple fruit. Characterization of ripening apple fruit Briefly, the first harvest took place on 4 Sept. in After the initial harvest dates, ‘normally-ripening’ fruit were harvested twice per week, every three to four days until ripening was imminent as judged by the average internal ethylene being greater than 0.1 µL L -1. At that time additional fruit were harvested and thereafter allowed to ripen in a high humidity, controlled environment chamber at 15 °C. Fruit were examined every three to four days until the conclusion of the study on 27 Oct. (day 53) in On each evaluation date, the 5 fruit having an internal ethylene content nearest the median of a 20-fruit sample were selected for analysis of CO 2 production and volatile emissions. As previously described by Contreras and Beaudry (2013), respiration was determined for whole fruit in a flow-through system at ambient temperature (22 ±1 °C). Fruit were sealed in 1-L Teflon containers (Savillex Corporation, Minnetonka, MN) flushed at approximately 40 mL min -1 with air. Volatile analysis was performed on the headspace of the 1-L containers following a 20 min incubation period during which the flow of air through the container was stopped. Volatiles were collected using a solid phase micro extraction (SPME) fiber (65 µm thickness PDMS-DVB, Supelco Inc., Bellefonte, PA) and separated by gas chromatography (HP-6890, Hewlett Packard Co., Wilmington, DE). Volatile detection was by time-of-flight mass spectrometry (TOFMS) using electron impact ionization (Pegasus II, LECO Corp., St. Joseph, MI). Identification of all quantified compounds was achieved by comparison of the mass spectrum with authenticated reference standards and with spectra in the National Institute for Standard and Technology (NIST) mass spectral library (Search version 1.5). Volatile compounds were quantified by calibrating with a known amount of an authenticated, high-purity standard mixture of 28 volatilized alcohols, aldehydes, and esters as previously described (Contreras and Beaudry, 2013). Following volatile analysis, fruit tissue was sampled by removing the epidermis and 2-3 mm of cortex with a manual rotary peeler (Model 8, Goodell, Antrim, NH), and immediately frozen in liquid nitrogen and stored at -80 °C. Tissue from five of the ten selected fruit was pooled into each of two biological replicates. Data for ethylene, respiration and volatile production was used to identify critical stages of development for LOX expression analysis (Figure 2). Eight stages were identified: immature apple (stage 1), mature with low levels of ethylene (stage 2), mature, low levels of ethylene just prior to the detection of hexyl esters (stage 3), mature/ripening with low but increasing levels of ethylene and low levels of hexyl esters (stage 4), ripening, autocatalytic ethylene synthesis engaged and rapidly increasing ester emissions (stage 5), ripening, at the peak of the respiratory climacteric (stage 6), ripe, at the peak of ester emissions and the onset of the decline in respiration (stage 7), and overripe/senescent with declining ester synthesis and respiratory activity (stage 8). References: Boeglin, W.E., Itoh, A., Zheng, Y., Coffa, G., Howe, G.A., and Brash, A.R. (2008). Investigation of substrate binding and product stereochemistry issues in two linoleate 9-lipoxygenases. Lipids 43, Coffa, G., and Brash, A.R. (2004). A single active site residue directs oxygenation stereospecificity in lipoxygenases, stereocontrol is linked to the position of oxygenation. Proc. Natl. Acad Sci. USA 101, Coffa, G., Imber, A.N., Maguire, B.C., Laxmikanthan, G., Schneider, C., Gaffney, B.J., and Brash, A.R. (2005). On the relationships of substrate orientation, hydrogen abstraction, and product stereochemistry in single and double dioxygenations by soybean lipoxygenase-1 and its Ala542Gly mutant. J. Biol. Chem. 280, Contreras, C., and Beaudry, R. (2013). Lipoxygenase-associated apple volatiles and their relationship with aroma perception during ripening. Postharv. Biol. Technol. 82, Feussner, I., and Wasternack, C. (2002). The lipoxygenase pathway. Annu. Rev. Plant Biol. 53, Gardner, H.W. (1989). Soybean lipoxygenase-1 enzymically forms both (9S)-and (13S)-hydroperoxides from linoleic acid by a pH- dependent mechanism. Biochim. Biophys. Acta 1001, Gillmor, S.A., Villaseñor, A., Fletterick, R., Sigal, E., and Browner, M.F. (1997). The structure of mammalian 15-lipoxygenase reveals similarity to the lipases and the determinants of substrate specificity. Nat. Struct. Mol. Biol. 4, Hornung, E., Kunze, S., Liavonchanka, A., Zimmermann, G., Kühn, D., Fritsche, K., Renz, A., Kühn, H., and Feussner, I. (2008). Identification of an amino acid determinant of pH regiospecificity in a seed lipoxygenase from Momordica charantia. Phytochemistry 69, Hornung, E., Walther, M., Kühn, H., and Feussner, I. (1999). Conversion of cucumber linoleate 13-lipoxygenase to a 9- lipoxygenating species by site-directed mutagenesis. Proc. Natl. Acad Sci. USA 96, Hughes, R., West, S., Hornostaj, A., Lawson, D., Fairhurst, S., Sanchez, R., Hough, P., Robinson, B., and Casey, R. (2001). Probing a novel potato lipoxygenase with dual positional specificity reveals primary determinants of substrate binding and requirements for a surface hydrophobic loop and has implications for the role of lipoxygenases in tubers. Biochem. J. 353, Ivanov, I., Heydeck, D., Hofheinz, K., Roffeis, J., O’Donnell, V.B., Kuhn, H., and Walther, M. (2010). Molecular enzymology of lipoxygenases. Arch. Biochem. Biophys. 503, Knapp, M.J., and Klinman, J.P. (2003). Kinetic studies of oxygen reactivity in soybean lipoxygenase-1. Biochemistry 42, Knapp, M.J., Seebeck, F.P., and Klinman, J.P. (2001). Steric control of oxygenation regiochemistry in soybean lipoxygenase-1. J. Am. Chem. Soc. 123, Palmieri-Thiers, C., Alberti, J.-C., Canaan, S., Brunini, V., Gambotti, C., Tomi, F., Oliw, E.H., Berti, L., and Maury, J. (2011). Identification of putative residues involved in the accessibility of the substrate-binding site of lipoxygenase by site-directed mutagenesis studies. Arch. Biochem. Biophys. 509, Sloane, D.L., Leung, R., Barnett, J., Craik, C.S., and Sigal, E. (1995). Conversion of human 15-lipoxygenase to an efficient 12- lipoxygenase, the side-chain geometry of amino acids 417 and 418 determine positional specificity. Protein Eng. 8,

14 Table S1 Identity of Malus x domestica lipoxygenases, and oligonucleotides used for gene amplification Locus GenBank acc. no. Description Upper primer Lower primer Annealing temperature Amplicon length Encoded protein length 5‘ position a sequence b 5‘ position a sequence c (°C) (bp) (amino acids) MDP KC MdLOX1a -48 TTATTCACAACATTCTTTGC ACGCTTGTTTGATCCCATAC MDP MdLOX1b -24 GAAACTGGAGGTCCGAC GGTCATACTTCTAGCATATCAC MDP KC MdLOX1c -37 ATTCGTGTAAAGCAAAGCAG GGTCATACTTCTAGCATATCAC MDP KC MdLOX1d -9 AGATCAAAGATGCTGCATTG CAAACAAAGAATCACAGAAGC MDP KC MdLOX2a -59 GGATTCAAACTTTCTCGAAC CCACCACCACCTCAAAATAA 65, MDP KC MdLOX2b -10 GAAGAAGAAGATGGCACTGACTA AAC CTAAATGTTGTTGAGAGTCATA TCG a from the translation start codon b underlined bases indicate the translation start codon c underlined bases indicate the translation stop codon

15

16

17 Table S4 Distribution of hydro(pero)xy products gained from wild-type and mutant apple LOXenzymereaction with α- linolenic acid and arachidonic acid. Proportions ofH(p)OTE and H(p)ETE products are given as per cent of total product amount obtained from specific LOX activity with LnA and AA, respectively. H(p)OTE products (%) H(p)ETE products (%) enzyme LOX1:Md:1a LOX1:Md:1c LOX2:Md:2a LOX2:Md:2b Arg268Ala Gly567Ala Ile578Leu Val582Phe

18 Table S5 Oligonucleotides used to amplifythe MdLOX1a, MdLOX1c, MdLOX2a and MdLOX2b genes for subcloning into pRSET B and pYES2 expression vectors. Primer name Sequence pRSET-L1a_XhoI_for ATAATACTCGAGCATGTTGCACAACCTGCT pRSET-L1a_NcoI_rev AATGTCCCATGGTTAGATAGAGACGCTGTTG pRSET-L1c_XhoI_for AGAACTCGAGAATGCTGCAGAATATCGTTG pRSET-L1c_KpnI_rev AGCTGGTACCTTAAATTGAGACACTGTTGG pRSET-L2a_XhoI_for ATAACTCGAGAATGGCACTGGCTAAAC pRSET-L2a_KpnI_rev CCCCTGGTACCTCATATCGAAATACTATTC pRSET-L2b_XhoI_for ACTACTCGAGAATGGCACTGACTAAAC pRSET-L2b_KpnI_rev TGCTGGTACCTCATATCGAAATACTATTAGG pYES_LOXhis_KpnI_for CAAGGTACCAACACAATGTCTGGTTCTCATCAT pYES_L1a_NotI_rev GTTGCGGCCGCTTAGATAGAGACG pYES_L1c_XbaI_rev GGCTCTAGATTAAATTGAGACACTGTTGG pYES_L2a/b_NotI_rev ACTGCGGCCGCTCATATCGAAATACTATT

19 Table S6 Oligonucleotides used for site-directed mutagenesis ofthe MdLOX1a gene. Mutant Methode Forward primer b Reverse primer b Arg268Ala oePCR a L1a_R268A_for CAAG A GATGAAGCATTTGG T CACTTG L1a_R268A_rev CAAGTG A CCAAATGCTTCATC T CTTG Ile566Phe oePCR a L1a_I566F_for GTACATCAA C GCATTTGG T AG A GG L1a_I566F_rev CC T CT A CCAAATGC G TTGATGTAC Gly567Ala QuikChange L1a_G567A_for CCATGTACATCAATGCAATTGCTAGGGGAATCCTCCTTAATGC L1a_G567A_rev GCATTAAGGAGGATTCCCCTAGCAATTGCATTGATGTACATGG Leu572Ile QuikChange L1a_L572I_for TTGGCAGGGGAATCCTC A TTAATGCTCGCGGAGTTATAGAG L1a_L572I_rev CTCTATAACTCCGCGAGCATTAA T GAGGATTCCCCTGCCAA Ile578Leu QuikChange L1a_I578L_for CCTTAATGCTCGCGGAGTTT TAGAGTCGACAGTTTTTCCAGC L1a_I578L_rev GCTGGAAAAACTGTCGACTCTA AAACTCCGCGAGCATTAAGG Val582Phe oePCR a L1a_V582F_for GTTATAGAGTC T ACATTCTTTCCAGCTAG L1a_V582F_rev CTAGCTGGAAAGAATGT A GACTCTATAAC Thr775Leu QuikChange L1a_T775L_for GACTGTACTTGGTATTGCCTTGATTGAGATTTTGTCAAGGC L1a_T775L_rev GCCTTGACAAAATCTCAATCAAGGCAATACCAAGTACAGTC a amplification of gene fragments was achieved in combination with pYES_LOXhis_KpnI_f and pYES_L1a_NotI_r (refer to table S5) b underlined bases indicate base exchanges for directed mutagenesis; bases in italic indicate conservative base exchanges tominimize the risk of hairpin and self-dimer formation


Download ppt "Supplemental data A dual positional specific lipoxygenase functions in the generation of flavour compounds during climacteric ripening of apple Schiller."

Similar presentations


Ads by Google