Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genome mapping Genome sequencing Next Gen sequencing.

Similar presentations


Presentation on theme: "Genome mapping Genome sequencing Next Gen sequencing."— Presentation transcript:

1 Genome mapping Genome sequencing Next Gen sequencing

2 Genomics = resources genome maps genome sequences genome clones DNA microarrays whole gene collections functional genomics!

3 DNA mapping Genomics = In the beginning……. ~

4

5 ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGT GTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCT AGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCA TTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACAT TGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGATTGACTCGGCAGC TCATCATGATAACTCCACAATTCCGTTGGATTTTATGCCCAGGGATGCTCTTCATGGATTTGATTGGTCTGAAGAGGATGACATGTCGGAT GGCTTGCCCTTCCTGAAAACGGACCCCAACAATAATGGGTTCTTTGGCGACGGTTCTCTCTTATGTATTCTTCGATCTATTGGCTTTAAAC CGGAAAATTACACGAACTCTAACGTTAACAGGCTCCCGACCATGATTACGGATAGATACACGTTGGCTTCTAGATCCACAACATCCCGTTT ACTTCAAAGTTATCTCAATAATTTTCACCCCTACTGCCCTATCGTGCACTCACCGACGCTAATGATGTTGTATAATAACCAGATTGAAATC GCGTCGAAGGATCAATGGCAAATCCTTTTTAACTGCATATTAGCCATTGGAGCCTGGTGTATAGAGGGGGAATCTACTGATATAGATGTTT TTTACTATCAAAATGCTAAATCTCATTTGACGAGCAAGGTCTTCGAGTCAGGTTCCATAATTTTGGTGACAGCCCTACATCTTCTGTCGCG ATATACACAGTGGAGGCAGAAAACAAATACTAGCTATAATTTTCACAGCTTTTCCATAAGAATGGCCATATCATTGGGCTTGAATAGGGAC CTCCCCTCGTCCTTCAGTGATAGCAGCATTCTGGAACAAAGACGCCGAATTTGGTGGTCTGTCTACTCTTGGGAGATCCAATTGTCCCTGC TTTATGGTCGATCCATCCAGCTTTCTCAGAATACAATCTCCTTCCCTTCTTCTGTCGACGATGTGCAGCGTACCACAACAGGTCCCACCAT ATATCATGGCATCATTGAAACAGCAAGGCTCTTACAAGTTTTCACAAAAATCTATGAACTAGACAAAACAGTAACTGCAGAAAAAAGTCCT ATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACCA CCGCTCTAACCAATTTGTTGAAGGAACACCCTTGGCTATCCTTTACAAGATTCGAACTGAAGTGGAAACAGTTGTCTCTTATCATTTATGT ATTAAGAGATTTTTTCACTAATTTTACCCAGAAAAAGTCACAACTAGAACAGGATCAAAATGATCATCAAAGTTATGAAGTTAAACGATGC TCCATCATGTTAAGCGATGCAGCACAAAGAACTGTTATGTCTGTAAGTAGCTATATGGACAATCATAATGTCACCCCATATTTTGCCTGGA ATTGTTCTTATTACTTGTTCAATGCAGTCCTAGTACCCATAAAGACTCTACTCTCAAACTCAAAATCGAATGCTGAGAATAACGAGACCGC ACAATTATTACAACAAATTAACACTGTTCTGATGCTATTAAAAAAACTGGCCACTTTTAAAATCCAGACTTGTGAAAAATACATTCAAGTA CTGGAAGAGGTATGTGCGCCGTTTCTGTTATCACAGTGTGCAATCCCATTACCGCATATCAGTTATAACAATAGTAATGGTAGCGCCATTA AAAATATTGTCGGTTCTGCAACTATCGCCCAATACCCTACTCTTCCGGAGGAAAATGTCAACAATATCAGTGTTAAATATGTTTCTCCTGG CTCAGTAGGGCCTTCACCTGTGCCATTGAAATCAGGAGCAAGTTTCAGTGATCTAGTCAAGCTGTTATCTAACCGTCCACCCTCTCGTAAC TCTCCAGTGACAATACCAAGAAGCACACCTTCGCATCGCTCAGTCACGCCTTTTCTAGGGCAACAGCAACAGCTGCAATCATTAGTGCCAC TGACCCCGTCTGCTTTGTTTGGTGGCGCCAATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAG CAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAAT AATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTG GAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAA AATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACC TTTATGGTCGATCCATCCAGCTTTCTCAGAATACAATCTCCTTCCCTTCTTCTGTCGACGATGTGCAGCGTACCACAACAGGTCCCACCAT ATATCATGGCATCATTGAAACAGCAAGGCTCTTACAAGTTTTCACAAAAATCTATGAACTAGACAAAACAGTAACTGCAGAAAAAAGTCCT ATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACCA ACTTCAAAGTTATCTCAATAATTTTCACCCCTACTGCCCTATCGTGCACTCACCGACGCTAATGATGTTGTATAATAACCAGATTGAAATC ( [G][A][T][C] ) 3,000,000,000

6 Cytogenetic Band 5-10 Mb ….TTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCA…. 1 bp resolution BACs YACs 100s to 1000s of Kb (0.1-1 Mb) Cosmids Plasmids 10s Of Kb resolution Physical maps

7 Genetic map of the Drosophila X chromosome 1913 Sturtevant, A. H The linear arrangement of six sex- linked factors in Drosophila, as shown by their mode of association. Journal of Experimental Zoology, 14: concept_11/con11bio.html

8 Genetic map of the yeast genome, 1960 Hawthorne & Mortimer GENETICS :

9 His - Trp - X a haploid  haploid Trp - His - a/  diploid

10 His - Trp - His - Trp - two meiotic divisions 100% parental meiosis

11 His - Trp - X a haploid  haploid Trp - His - a/  diploid

12 His - Trp - His - Trp - two meiotic divisions 50% parental 50% recombinant (non-parental) His - Trp -

13 His - Trp - His - Trp - two meiotic divisions 100% parental 0% recombinant (non-parental) Trp - His -

14 Trp - His - Trp - two meiotic divisions 50% recombinant His - Trp -

15 His - Trp - His - Trp - two meiotic divisions 0% recombinant Trp - <50% recombinant genes “linked” >> His -

16 Trp - His - Trp - two meiotic divisions 50% parental 50% recombinant (non-parental) His - Trp - Tetratype

17 His - Trp - His - Trp - two meiotic divisions 100% parental Parental ditype

18 Mortimer & Hawthorne GENETICS 53: % recombinants 0% recombinants 40% recombinants 16% recombinants T = 49 * 4 = 196 spores/2 = 98r PD = 14 * 4 = 56 spores = 0r NPD = 15 * 4 = 56 spores = 56r 308 spores 154r

19 Mortimer & Hawthorne GENETICS 53: c

20 Cytogenetic Band 5-10 Mb Genetic Map Cm YACs ~1 Mb BACs ~150 Kb λ clones ~15 Kb

21

22

23 GENETICS 134: (1993)

24 YAC ClonesCosmid Clones Genome the more pieces in the puzzle, the harder it is to assemble

25 Marra et al., 1997 High throughput fingerprint analysis of large-insert clones. Genome Res. 7:1072

26 Genome mapping Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578 “finishing”

27 Marra et al., 1997 High throughput fingerprint analysis of large-insert clones. Genome Res. 7:1072 “Finishing”

28 Genome mapping Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578 “finishing”

29 “Sequence-ready” BAC map Green ED Nat Rev Genetics :573-83

30 Genome maps Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578

31 CTAGTACTGTCG CAGTGCTATTAG bp STS: SequenceTagged Sites

32 Closely linked STSsSTSs farther apart closely linked markersmarkers farther apart

33 T.A. Brown GENOMES 2 BIOS Scientific Publishers Ltd, 2002 Radiation hybrid cell lines

34 Cox DR et al Radiation hybrid mapping: a somatic cell genetic method for constructing high resolution maps of mammalian chromosomes. Science 250: 245–250. PMID: Radiation hybrid mapping

35 His - Trp - His - Trp - two meiotic divisions 50% recominant >> 0% recombinant Trp -

36 Cox DR et al Radiation hybrid mapping: a somatic cell genetic method for constructing high resolution maps of mammalian chromosomes. Science 250: 245–250. PMID: Radiation hybrid mapping CTAGTACTGTCG CAGTGCTATTA G

37 Human Molecular Genetics 2, Strachan and Read © 1999 Garland Science STS content mapping

38 Eric Green, NHGRI

39 Cytogenetic Band 5-10 Mb YACs ~1 Mb BACs ~150 Kb STS mapping fingerprint mapping

40 RFLPs Donis-Keller H et al. A genetic map of the human genome. Cell. (1987); 51: 319–337 PMID: Human Genome Genetic Map Mb resolution probe X X haplotypes

41 Human Genome Genetic Map 1996 <1 Mb resolution SSLPS Dib C et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature. (1996) 380: 152–154 PMID:

42 Human Genome Genetic Map “Sequence-ready” BAC map


Download ppt "Genome mapping Genome sequencing Next Gen sequencing."

Similar presentations


Ads by Google