Presentation is loading. Please wait.

Presentation is loading. Please wait.

Salk Institute Mobile Lab Review: We extracted DNA from wheat germ And discovered that the color of DNA is … No matter what organism it comes from, DNA.

Similar presentations


Presentation on theme: "Salk Institute Mobile Lab Review: We extracted DNA from wheat germ And discovered that the color of DNA is … No matter what organism it comes from, DNA."— Presentation transcript:

1 Salk Institute Mobile Lab Review: We extracted DNA from wheat germ And discovered that the color of DNA is … No matter what organism it comes from, DNA in a tube looks the same! WHITE!

2 Salk Institute Mobile Lab So how can scientists tell different DNA apart?

3 Salk Institute Mobile Lab So how can scientists tell different DNA apart? Remember that DNA is a long molecule of A, T, G, CATTTCGCAATTAGGCATCGGACGTAGCCTAGGCAGTCGATCGTCAGTCTTCTAACCGGATACCAGACCAGGTCCCGTTAACGCGGATATAGCCTGTCAGCTGATGGACATCGACTCTGAACTCGACACATCCCTTAACCGATCGTCTCTGACCTCGACCTGACGCGGTAACTGATCTCCCGATCCCCGATCCTGATGACACAGCTCGACTCCGACATCGCCCAGCTTAAGCTACGGGACTAGCATCGATCGATCGTTGACCAGCTAGCTCTGACCTCGACCTGACCGGGATAGCTCTAGCTCTGAGAGCTCGTGAAACCGTAAAATCGTCTCTGATATAGCCCGACCTTCGGATATACGTTCTGTTAGACTGTGACAGCTTAGCTAGCGGTAGATCGATAGCT +  Restriction Enzymes which act like Chemical “scissors”

4 Salk Institute Mobile Lab So how can scientists tell different DNA apart? Remember that DNA is a long molecule of A, T, G, C ATGGTACGCATGGTCTCGAGCATAGCTTTCATGGCTTCATCATCAT   

5 Salk Institute Mobile Lab Result: Lots of different size pieces of DNA ATTTCAT TAGGCAT GACGTACAT TAGGCAGTCGATCGTCAGTCCAT AACCGGATACAT TAGACCAGGTCCAT TTAACGCGGATATAGCCTGTCAGCTGATGGACATCGACTCTGAACTCGACACACAT TAACCGATCGTCTCTGACCTCGACCTGCAT CGGTAACTGATCTCCCGATCCCCGATCCTGATGACACAGCTCGACTCCGACTTCGCCCAGCTTAAGCTACGGGACTAGCGTCGATCGACCAT TTGACCAGCTAGCTCTCAT CTCGACCTCAT CGGGATAGCTCTAGCTCTGAGCAT CCAT TCAT CAT CGCAT AAATCGTCAT CCAT

6 Salk Institute Mobile Lab ATTTCAT TAGGCAT GACGTACAT TAGGCAGTCGATCGTCAGTCCAT AACCGGATACAT TAGACCAGGTCCAT TTAACGCGGATATAGCCTGTCAGCTGATGGACATCGACTCTGAACTCGACACACAT TAACCGATCGTCTCTGACCTCGACCTGCAT CGGTAACTGATCTCCCGATCCCCGATCCTGATGACACAGCTCGACTCCGACTTCGCCCAGCTTAAGCTACGGGACTAGCGTCGATCGACCAT TTGACCAGCTAGCTCTCAT CTCGACCTCAT CGGGATAGCTCTAGCTCTGAGCAT CCAT TCAT CAT CGCAT AAATCGTCAT CCAT Next step is to sort the pieces by size using Gel Electrophoresis

7 Salk Institute Mobile Lab Gel Electrophoresis Gel is made from Agarose powder which comes from seaweed DNA pieces go here Apply electricity Bigger pieces  Smaller pieces DNA pieces separated by SIZE!

8 Salk Institute Mobile Lab So how do scientists tell different DNA apart? Everyone ’ s DNA is unique! –So everyone ’ s DNA gets cut up differently! Apply electricity Bigger pieces  Smaller pieces Different Patterns! Different DNA samples

9 Salk Institute Mobile Lab DNA Fingerprinting Unique DNA = Unique patterns –Just like your fingerprints are unique! Apply electricity Bigger pieces  Smaller pieces Different Patterns! Different DNA samples

10 Salk Institute Mobile Lab DNA Fingerprinting Unique DNA = Unique patterns –Just like your fingerprints are unique! Apply electricity Bigger pieces  Smaller pieces Different Patterns! Different DNA samples Zoologists use it for animal breeding Forensic Scientists use it to solve crime scenes Oncologists use it to research cancer genes Marine Biologists use it to identify new species Immunologists use it to study mutated viruses Geneticists use it to determine evolution patterns

11 Salk Institute Mobile Lab In labs we use a carcinogen called EtBr to make the DNA show up Food color dyes have their own color!

12 Salk Institute Mobile Lab Who should understand DNA? New DNA Evidence in Duke Lacrosse Case


Download ppt "Salk Institute Mobile Lab Review: We extracted DNA from wheat germ And discovered that the color of DNA is … No matter what organism it comes from, DNA."

Similar presentations


Ads by Google