Presentation is loading. Please wait.

Presentation is loading. Please wait.

Making the Big Connection How can we be sure that DNA is really the stuff that encodes genetic information ? n After all DNA is really just a big sugar,

Similar presentations


Presentation on theme: "Making the Big Connection How can we be sure that DNA is really the stuff that encodes genetic information ? n After all DNA is really just a big sugar,"— Presentation transcript:

1 Making the Big Connection How can we be sure that DNA is really the stuff that encodes genetic information ? n After all DNA is really just a big sugar, isnt it?. (Not!) n DNA isn’t nearly complex enough to store genetic information. n Only proteins are versatile enough to be able to store something as complex as hereditary information. n I’m sorry but I just don’t come from green puss running out of an infection.

2 The Landmark Experiments n Fred Griffith u Transforming Principle of Pneumococcus (Whole Oganism Approach) n Avery, MacLeod and McCarty u Transforming Principle of Pneumococcus (Chemical Breakdown Approach) n Barbara McClintock u Jumping Genes in Corn n Hershey and Chase u The final nail in the coffin - The Blender Test

3 Fred Griffith Avery, MacLeod and McCarty Hershey and Chase

4 The Griffith Experiments 1928 n Pneumococcus is a kind of bacterium that can cause death. n Pneumococcus comes in two varieties. u Avirulent “II-R” - Rough Colonies, Not sugar coated u Virulent “III-S” - Smooth Colonies, Sugar coated n II-R vs. III-S strains are gentically different.

5

6 Type III-S bacteria are pathogenic. Injection into mice results in pneumonia and death. Is this expected?

7 Type II-R bacteria are not pathogenic. Injection into mice results in no pathology. Is this expected?

8 Type III-S bacteria are pathogenic. Heat killed bacteria should not be deadly. Injection into mice does not result in any pathology. Is this expected?

9 Type III-S bacteria are pathogenic. Type II-R bacteria are not pathogenic. Injection into mice of living II-R and dead III-S results in pneumonia and death. Is this expected?

10 The Avery, MacLeod and McCarty Experiments (Hello Reductionism!) n Pneumococcus is a kind of bacterium that can cause death. n Pneumococcus comes in two varieties. u Avirulent “II-R” - Rough Colonies, Not sugar coated u Virulent “III-S” - Smooth Colonies, Sugar coated n II-R vs. III-S strains are genetically different.

11 Type II-R bacteria form rough colonies. Type II-R bacteria placed on agar will grow to form rough colonies. Is this expected?

12 Type III-S bacteria form smooth colonies. Dead bacteria don’t grow on agar or anything else. Is this expected?

13 Type II-R bacteria form rough colonies. Type III-S bacteria form smooth colonies. Mixing type II-R bacteria with DNA from dead III-S produced smooth colonies Say what ?!

14 Type II-R bacteria form rough colonies. Type III-S bacteria form smooth colonies. Mixing type II-R bacteria with DNA from dead III-S produced smooth colonies; protease doesn’t stop this. What does this mean?

15 Type II-R bacteria form rough colonies. Type III-S bacteria form smooth colonies. Mixing type II-R bacteria with DNA from dead III-S produced smooth colonies; RNase doesn’t stop this. What does this mean?

16 Type II-R bacteria form rough colonies. Type III-S bacteria form smooth colonies. Mixing type II-R bacteria with DNA from dead III-S produced smooth colonies; DNase stops this. What does this mean?

17 Human Genetic Traits Clinodactyly (curved middle finger) Albinism

18 Human Genetic Traits Hairy Ears (Y-Chromosome) Progeria (Genetic Lethal)

19 Proteins n Composition: C, H, O, and sometimes S and N. n Examples: Egg Whites, Hair, Hemoglobin, Insulin, Collagen, Antibodies n Significance: u Reaction catalysts (i.e., they facilitate chemical reactions) u Transportation / storage of small molecules / ions. u Coordinated motion (e.g., muscle action) u Mechanical support (e.g., strengthen skin and bone) u Immune Protection (e.g., antibodies) u Regulate ion movement (e.g., nerve impulses)

20

21

22

23

24 Protein Secondary Structure

25 Secondary Structure (  helix and  pleated sheet)

26 Kuru Neurodegenerative disease characterized by ataxia / dementia Brain Section

27 Tertiary Structure

28 The structure of the Staphylococcus aureus alpha-hemolysin pore determined to 1.9 A resolution. Alpha-hemolysin is a water-soluble protein toxin that can self-assemble into a transmembrane pore of defined structure. Shown is the side-view of the assembly, as it would span the membrane. Within the mushroom-shaped homo-oligomeric heptamer is a solvent-filled channel, 100 A in length, that runs along the sevenfold axis and ranges from 14 A to 46 A in diameter. Staphylococcus aureus Hemolysin heptamer Quaternary Structure

29 S. aureus Hemolysin heptamer Quaternary Structure

30 Factors that Impact Protein Function

31 The Central (and almost correct) Dogma DNA (Genes) RNA (mRNA) Proteins (cell labor) Transcription Translation Make an mRNA copy of the information contained in the DNA Information stored in mRNA is used to direct the construction of proteins.

32 The Master Molecule The Power Behind DNA The  and The  RNA

33 Ribonucleic Acid - RNA n The Nucleic Acid Jezabelle n Functional Forms: u Messenger RNA (mRNA) u Transfer RNA (tRNA) u Ribosomal RNA (rRNA) n Significance: u Medium of genetic communication (mRNA is the voice of DNA) u Molecular shipping service (tRNA transports amino acids for protein manufacture) u Molecular industrialist (rRNA manufactures proteins) u Non-protein enzyme (ribozyme) u Excise/Rewrite Genetic Information u Chromosome Maintenance u Information Storage Molecule u Possibly the oldest self-replicating biomolecule.

34 RNA Structure n RNA is not a regular double helix. RNA structure almost always involves folding of the RNA upon itself.

35 mRNA: the voice of DNA n DNA, itself, cannot direct protein production n RNA is a cheap, disposable copy of the DNA information except that "U" replaces "T". n mRNA contains information on: u 1) where to start protein construction u 2) how to construct the protein (the amino acid sequence) u 3) where to stop protein construction u 4) time before mRNA self-destruction

36 mRNA mRNA contains all instructions that are required for the assembly of a functional protein.

37 tRNA: FedEx of Protein Production n Amino acids are the building blocks of proteins n The protein manufacturing facilities (ribosomes) do not have a stock of amino acids but rely on a "Just-in-Time" delivery system. n Each of sixty-one different tRNAs are specific for only one of twenty different amino acids. n tRNAs have a dual job: u 1) they pick up amino acids (one at a time) and deliver them to the protein factories (ribosomes) u 2) they participate in protein construction by interfacing with the mRNA on the assembly line

38 tRNA - Transfer RNA tRNA: squashed like a bug tRNA: the 3D beauty tRNA: the 3D beauty

39 rRNA: Protein Production by Ford n Amino acids are assembled into proteins at ribosomes. n The ribosomes are built from a combination of up to 82 proteins and as many as 4 ribosomal RNAs (rRNA). n Ribosomes participate in protein manufacturing in two ways: u 1) by providing a site for mRNA to interface with tRNAs carrying amino acids u 2) by gluing the amino acids together to form a chain (protein) according to the instructions of the mRNA.

40 rRNA - Ribosomal RNA/Ribosome

41

42 The Central (and almost correct) Dogma DNA (Genes) RNA (mRNA) Proteins (cell labor) Transcription Translation Make an mRNA copy of the information contained in the DNA Information stored in mRNA is used to direct the construction of proteins.

43 Transcription: Making an RNA copy of DNA. n DNA: Double Stranded n DNA strands separate to allow an RNA copy to be made. n Single strand mRNA is the final product

44 Transcription: Making an RNA copy of DNA. Synthesis of mRNA does not change the original DNA sequence in any way.

45 The DNA can be copied over and over each time it necessary to produce a given protein. Transcription: Making an RNA copy of DNA.

46 Cracking the Genetic Code There are twenty amino acids. How many DNA letters (GATC) code for a single amino acid? There are a total of 16 possible two-letter combinations (4 2 ). GGGAGUGC AGAAAUAC UGUAUUUC CGCACUCC There are a total of 64 possible three-letter combinations (4 3 ).

47 Magic mRNA Decoder Ring

48 Initiation of Translation n Step #1 in protein synthesis is assembly of an mRNA / Ribosome initiation complex. This requires: OH Ribosome Large Subunit Small Subunit P UAACGAGUGAGAGAUGAAUGAUGAC U GAC U GA ~ Empty “A” site UAC M Methionine tRNA at “P” site  Methionine is the first amino acid in almost all proteins. Shine-Delgarno Sequence  mRNA binds to a docking site on the ribosome (Shine- Delgarno sequence)

49 Elongation of the Protein P OH UAAUGAGUGAGAGAUGACUGAUGAC U GAC U GA ~ UAC M mRNA Ribosome P OH UAAUGAGUGAGAGAUGACUGAUGAC U GAC U GA ~ UAC M mRNA UUU K A bond is formed between amino acids “M” and “K”. This releases the tRNA from “M” tRNA carrying the amino acid lysine (K) enters the “A” site UUU K tRNA exits through to get another amino acid (M) The ribosome then moves forward and to shift the tRNA with amino acids “MK” to the “P” site

50 P OH UAAUGAGUGUGACAUGACUGAUGAC U GAC U GA ~ UAG I mRNA Ribosome Termination of a Newly Made Protein MKVF Ribosomes stall at termination codons until the translation complex falls apart. The translation complex disengages in preparation for the next round of synthesis ~ C P OH UAAUGAGUGTGACAUGAUGAUGAC U GAC U GA mRNA Ribosome Large Subunit I MKVF Ribosome Small Subunit

51 Transcription and Translation 5’GGG TAT CGA ATT TTT CAT TGG CTG GGC 3’ 3’CCC ATA GCT TAA AAA GTA ACC GAC CCG 5’ DNA 5’GGG UAU CGA AUU UUU CAU UGG CUG GGC 3’ RNA Protein G Y R I F H W L G


Download ppt "Making the Big Connection How can we be sure that DNA is really the stuff that encodes genetic information ? n After all DNA is really just a big sugar,"

Similar presentations


Ads by Google