Presentation is loading. Please wait.

Presentation is loading. Please wait.

TNBC Supplementary Figure 1 d e f HD PEST Notch pathway activation (TNBC cases only) c a b NOTCH1 NOTCH2 NOTCH3.

Similar presentations


Presentation on theme: "TNBC Supplementary Figure 1 d e f HD PEST Notch pathway activation (TNBC cases only) c a b NOTCH1 NOTCH2 NOTCH3."— Presentation transcript:

1 TNBC Supplementary Figure 1 d e f HD PEST Notch pathway activation (TNBC cases only) c a b NOTCH1 NOTCH2 NOTCH3

2 Supplementary Figure 2 NOTCH4 a b

3 Supplementary Figure 3 TCGA-BH-A1FC, ∆exon21-27 Canonical NOTCH1 transcript TCGA-A2-A0T0, chr9:139,390, ,390,695 deletion TCGA-A8-A08X, chr9:139,391,422 inter-chromosomal translocation Canonical NOTCH2 transcript TCGA-AO-A0J6, chr1:120,458, ,458,786 deletion a b To: chr14:30,447,409 c TCGA-AN-A0AR, BRD4(exon1)-NOTCH3(exon 26) fusion & chr19:15,270,914-15,272,239 deletion NOTCH3BRD4EPHX3

4 TCGA-BH-A1FC Tumor TCGA-BH-A1FC Matched Normal a bc d 9q NOTCH Exon deletion S1S2S3 Supplementary Figure 4 ef

5 19p Kb NOTCH3 BRD4 1226bp deletion ab c Supplementary Figure 5 S1S2S3 Notch3 wild-type Mutant Notch3 in TCGA-AN-A0AR Notch3 p.M1583Notch3 p.P2067Rfs*84 d

6 Pfizer Confidential │ 6 TCGA-A2-A0T0TCGA-A8-A08XTCGA-A8-A0J6 RNA-Seq in tumor WXS in tumor WXS in matched normal abc Supplementary Figure 6

7 a b Supplementary Figure 7

8 Chromosome Position (MB) log2 CN ratio c a b d Supplementary Figure 8 e f g TGTGAGCAGA CCCGCTGGTT h i Exon 34 Intron 30 Junction CCACTGGGCCCC CTGGGGTGATACCGCAGG j k l 1p121q21.1 chr1: chr1: NOTCH Intronic 34* chr1: p121q ’ * 5’ - - 3’ NOTCH2Intronic 9q * NOTCH1 chr9: chr9: q34.3 NOTCH1 1 5’ - - 3’ ’ * chr9:

9 Supplementary Figure 9 TCTCGAGATGGAGATTGGAGATTG wt deletion GCATTCCAACTTTAGCACAAGG CCAGCTACAGCTATGCTGA AGCGACGTGGGCTCTCCTGGGGC GGCAGCGACGTGGGCAGGGCGGGGCTCTCCTGGGGC c a b d e f g 9q NOTCH1 34* * 4q32.3 chr4: Intergenic chr9: chr9: chr9: q34.3 4q32.3 Intergenic NOTCH ’ - - 3’ 34’ * chr4: Alt. splicing chr9: – chr4: ’ unsplicedspliced

10 Supplementary Figure 10 a b HCC1937 HBCx5 HBCx17 HBCx12B AA0869 MDA-MB-231 BT-474 HCC1806

11 Supplementary Figure 11 a b 80 KDa 110 KDa 160 KDa NICD1 MDAMB HBCx PF4014 HCC GAPDH 40 KDa c HBCx14 HCC1599HBCx12B PF KDa 160 KDa NICD1 GAPDH 40 KDa 110 KDa 160 KDa NICD1 HCC1937 HBCx14 HCC PF4014 GAPDH 40 KDa -

12 Notch wt Notch mutant Notch wt Notch mutant Notch wt Notch mutant Notch wt Notch mutant Supplementary Figure 12 PF-4014 * * * * * ** * *

13 Notch wt Notch mutant Notch wt Notch mutant Notch wt Notch mutant Notch wt Notch mutant Supplementary Figure 13 PF-4014 * * * * ** * * * * * * * *


Download ppt "TNBC Supplementary Figure 1 d e f HD PEST Notch pathway activation (TNBC cases only) c a b NOTCH1 NOTCH2 NOTCH3."

Similar presentations


Ads by Google