Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 Introgression mapping in the grasses Lolium perenne and Festuca pratensis Julie King.

Similar presentations


Presentation on theme: "1 Introgression mapping in the grasses Lolium perenne and Festuca pratensis Julie King."— Presentation transcript:

1 1 Introgression mapping in the grasses Lolium perenne and Festuca pratensis Julie King

2 2 LpLpLpLp x FpFp (28) (14) LpLpFp x LpLp (21) (14) BC 1 (14) Production of substitution lines

3 3

4 4 Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7

5 5 LpLpLpLp x FpFp (28) (14) LpLpFp x LpLp (21) (14) LpLp(Fp) x LpLp (13Lp+1Fp) (14) LpLp(Fp) (14) BC 1 BC 2 BC 2 introgression population

6 6 Lolium 2n=2x=14 7 Lolium/Festuca substitutions Lolium/Festuca substitution lines

7 7 Introgression chromosome series X

8 8 Genetic map of chromosome 3

9 9

10 /26 3 3/ /3 3/ / BC 2 plants used for physical mapping

11 11

12 12 RZ783, C112 C949 CDO345 C250, C122, WG889, BCD128 CDO455 R1928, PSR370, RZ382, PSR394, CDO920 R1613 CDO328 CDO466, C30

13 13 Rice chromosome 1: BAC No. BAC/PAC BAC/PAC coordinates 1 P0672D08 1 – 173,729 3 P0005A05 300,777 – 436,798 8 P0463F06 851,331 – 919, P0037C04 1,345,101 – 1,437, P0408F06 1,566,828 – 1,698, P0024G09 2,381,624 – 2,444, P0009G03 2,715,057 – 2,855,651…

14 14 BAC 227 (PAC clone PO686E09) Festuca AATTCTGGTTCATGTGTTCCTGTCGACATTGAGTGGCCTCCTAGAAGAGCA Lolium (4n) AATTCTGGTTCATGTGTTCCTGTCGACATTGAGTGGCCTCCTAGAAGAGCA Lolium (2n) AATTCTGGTTCATGTGTTCCTGTCGACATTGAGTGGCCTCCTAGAAGAGCA CATCATCTGAACTTTAATGCACCATTTTCTATGAACATGGATACTAAATCTG GAGAGCTGTCAAATGACGGACTCAATGATGTCGATCCTTTTGCCGATTGGC GAGAGCTGTCAAATGACGGACTCAATGATGTTGATCCTTTTGCCGATTGGC

15 15 BAC mapping discrepancies BACSubline

16 16

17 17, NOR. Centromere Genetic Distance cM 0 Physical distance % Genotype 11  3/26  6  3  3/10  36  17  83  92  3/2  99  83  19  56  3/23  2/3  18  % BACs 82% BACs 9% BACs 15.5% 64.5% 20%

18 18

19 19, NOR. Centromere Genetic Distance cM 0 Physical distance % Genotype 11  3/26  6  3  3/10  36  17  83  92  3/2  99  83  19  56  3/23  2/3  18  % recombination = very low 50% BACs 47% genes 53% = T + H

20 20 Determining genetic control of target traits Locate gene(s) controlling trait to chromosome(s) using substitution lines. Locate gene(s) controlling trait to a particular bin using physical mapping population. Use bin mapped rice BACs to exploit rice genome for further markers /candidate genes. Springboard for gene isolation.

21 21 Nutrient use efficiency High nitrogen uptake - chr. 3 High nitrogen utilisation - chr. 4

22 22 All involved: Ian King Ian Armstead Iain Donnison Luned Roberts John Harper Kirsten Skot Lin Huang


Download ppt "1 Introgression mapping in the grasses Lolium perenne and Festuca pratensis Julie King."

Similar presentations


Ads by Google