Presentation is loading. Please wait.

Presentation is loading. Please wait.

Molecular Clock: An Interesting Application Xuhua Xia

Similar presentations


Presentation on theme: "Molecular Clock: An Interesting Application Xuhua Xia"— Presentation transcript:

1 Molecular Clock: An Interesting Application Xuhua Xia

2 Xuhua Xia Slide 2 Objectives Comprehend one of the two major components in molecular phylogenetics, dating speciation events. (What is the other component?) Understand the concept of a molecular clock and its two meanings: –as a measure of time (after calibration) –as a measure of the rate of change Learn to calibrate the molecular clock and how to use it to solve practical biological problems

3 Xuhua Xia Slide 3 The Origin of Darwin’s Fox Chiloé Island Yahnke, C. J., W. E. Johnson, E. Geffen, D. Smith, F. Hertel, M. S. Roy, C. F. Bonacic et al Darwin's fox: A distinct endangered species in a vanishing habitat. Conservation Biology 10:

4 Xuhua Xia Slide 4 Dusicyon fulvipes In the evening we reached the island of S. Pedro...two of the officers landed to take a round of angles with the theodilite. A fox, of a kind said to be peculiar to the island, and very rare in it, and which is an undescribed species, was sitting on the rocks. He was so intently absorbed in watching their manoeuvres, that I was able, by quietly walking up behind, to knock him on the head with my geological hammer. This fox, more curious or more scientific, but less wise, than the generality of his brethren, is now mounted in the museum of the Zoological Society. --C. Darwin Journal of researches in the geology and natural history of the various countries visited by H.M.S. Beagle, under the command of Captain Fitzroy, R. N. from Henry Colburn, London. P. 341.

5 Xuhua Xia Slide 5 Conventional Hypothesis Gray foxes on the mainland have frequently migrated to the island during the ice ages when the sea level was much lower than it is today After the last glaciation period which ended about years ago, the sea level rose isolating the island from the mainland. The gray fox population on the island then evolved independently from that of the mainland and the two gradually diverge from each other. The Darwin’s fox is the product of this isolated evolution of the ancestral gray fox on the Chiloé Island. Prediction: The genetic difference should be small and comparable to the divergence time of ~15000 years.

6 Xuhua Xia Slide 6 The Challenge to the Hypothesis Differences between Darwin’s fox and gray fox –Morphological –Behavioral A mainland population was found (Medel, R. G., J. E. Jimenez, F. M. Jaksic, J. L. Yanez, and J. J. Armesto Discovery of a continental population of the rare Darwin's fox, Dusicyon fulvipes, new record (Martin, 1837) in Chile. Biological Conservation 51:71-78.): Reproductive isolation Ancient origin of Darwin’s fox? –Scientific significance: the two criteria of species conservation. –Methodology: molecular clock

7 Xuhua Xia Slide 7 Mechanical Clock We can obtain the length of time by counting the number of ticks. How does a molecular clock tick?

8 Xuhua Xia Slide 8 Factors Affecting DNA Evolution Types of Mutation –Point mutation –Insertion –Deletion –Inversion –Duplication ATG AAA CCC CGG GGC CCC TAT TTT TTG ATG AAA CCC CGA GGC CCC TAT TTT TTG ATG AAA CCC CGG AAA AAA GGC CCC TAT TTT TTG ATG AAA CCC CGG CCC CGG TAT TTT TTG ATG AAA CCC CGG GGC CCC TAT TTT TTT TTT TTG

9 Xuhua Xia Slide 9 How Does a Molecular Clock Tick? ATGACCCCGACACGCAAAATTAACCCACTAATAAAATTAATTAATCACTCATTTATCGAC ATGACCTCGACACGCAAAATTAACCCACTAATAAAGTTAATTAATCACTCATTTATCGAC ATGACCTCGACACGCAAAATGAACCCACTAATAAAGTTAATTAATCACTCATTTATCGAC ATGACCCCGACACGCAAAATTAACCCACTAATAAAGTTAATTAATCACTCATTTATCGAC ATGACCTCGACACGCAAAATGAACCCACTAATAAAGTTAATTAATCACTCATTTATCGAC Each nucleotide substitution is equivalent to one tick in a mechanical clock. The more nucleotide substitutions, the longer the time is.

10 Xuhua Xia Slide 10 A Major Difference The Molecular clock is an irregular (or even sporadic) clock. However, we could still say that, on average, this particular DNA clock, or that particular protein clock, ticks once every million years. But how do we know when is the beginning of the time? We don’t have the ancestral sequence available for comparison.

11 Xuhua Xia Slide 11 Divergence from a Common Ancestor AAA CCC CGG GGC CCC TAT TTT TTG AAA CCC CGG GGC CCC TAT TTT TTT AAT CTC CGG GGC CCC TAT TTT TTT AAT CTC CGG GGC CTC TAT TTT TTT AAG CCT CGG GGC CCC TAT TTT TTG AAG CCT CGG GGC CCT TAT TTT TTG AAG CCC CGG GGC CCC TAT TTT TTG

12 Xuhua Xia Slide 12 Sequence Divergence Sequence length: 24 Identical pairs: 18 Number of nucleotide differences per site: d = (24-18)/24 = 0.25 or d’ = -ln(1-d) = 0.288, called the Poisson-corrected P- distance, is a better estimate because it partially corrects for multiple hits (partially because it does not correct for substitutions such as A  G  A) How can we translate this into divergence time, i.e., how many years have Species 1 and 2 diverged from each other? Sp1: AAG CCT CGG GGC CCT TAT TTT TTG || | ||| ||| | ||| ||| || Sp2: AAT CTC CGG GGC CTC TAT TTT TTT

13 Xuhua Xia Slide 13 Sedimentary Rocks and Fossils If fossils of rats and mice are found in one stratum, but not in any older strata, then, if the stratum is found to be 15 million years old, we can infer that mice and rats must have diverged 15 millions years ago. Sedimentary rocks form on top of older rocks, with fossils buried inside.

14 Xuhua Xia Slide 14 Calibration of the Molecular Clock: I The same calibration can be made with any genetic distances (e.g., those calculated from DNA hybridization or allelic frequencies)

15 Xuhua Xia Slide 15 Different ways of calibration: II IAU79453 IAU79450 IAU05331 IAU79451 IAU37172 IAU37171 IAU37176 IAU37181 IAU37180 FLAHAOHF FLAHA1N IAU11858 IVHATG Divergence Time (10000) Genetic Distance years

16 Xuhua Xia Slide 16 The Challenge to the Hypothesis Mitochondrial DNA genes were sequenced from Darwin’s fox, the gray fox and other related foxes. According a calibrated molecular clock, the divergence time is estimated to be ~2 million years, which is much greater than the expected divergence time of ~15000 years. Darwin’s fox Mainland gray fox 2 myr

17 Xuhua Xia Slide 17 Conclusions Darwin’s fox had diverged from the gray fox millions of years ago on the mainland, long before the Chiloé island was formed. After the formation of Chiloé Island, some Darwin’s foxes, not gray foxes, migrated to the island and became established. Meanwhile, the mainland population had gone extinct. Darwin’s fox is an independent species and its conservation is urgent (only about 500 left).

18 Xuhua Xia Slide 18 Divergence time Island Darwin’s fox Mainland Darwin’s fox Mainland gray fox 2 myr Afternoon Lab: Testing the validity of the molecular hypothesis

19 Xuhua Xia Slide 19 Testing the Molecular Clock Distance-based tests Likelihood ratio tests –The tree-based test –The relative-rate test Nucleotide-based analysis (Muse and Gaut 1992) Codon-based analysis (Muse and Gaut 1994)

20 Xuhua Xia Slide 20 Relative-rate tests Outgroup Ingroup 2 Ingroup 1 1111 2222 Constraint both:  1 =  2 = ,  1 =  2 =  (2 parameters) General model:  1,  2,  1,  2 (4 parameters) Constrain  :  1 =  2 = ,  1,  2 (3 parameters) Constrain  :  1,  2,  1 =  2 =  (3 parameters) Likelihood ratio test:  2 = 2  lnL, DF =  Parameter 3333

21 Xuhua Xia Slide 21 Tree-based tests BosTaurus BalaenopteraMusculus PongoPygmaeus PanTroglodytes HomoSapiens GallusGallus AlligatorMississippiensis x1x1 x5x5 x7x7 x2x2 x6x6 x5x5 x4x4 x3x3 x2x2 x6x6 x1x1 x4x4 x3x3 x8x8 x 10 x 11 x9x9 AlligatorMississippiensis GallusGallus BalaenopteraMusculus BosTaurus PongoPygmaeus PanTroglodytes HomoSapiens DF for LRT: n - 2

22 Xuhua Xia Slide 22 Tree-based tests S5 S4 S3 S2 S1 S6 S7 x5x5 x7x7 x2x2 x6x6 x1x1 x4x4 x3x3 x8x8 x 10 x 11 x9x9 d’ 12 = x 1 + x 2 d’ 13 = x 1 + x 4 + x 3... d’ 67 = x 10 + x 11 RSS nc =  (d ij – d’ ij ) 2 d’ 12 = 2 x 1 d’ 13 = 2 (x 1 + x 2 )... d’ 67 = 2 ( x 5 + x 6 ) RSS c =  (d ij – d’ ij ) 2 x1x1 x5x5 x4x4 x3x3 x2x2 x6x6 S7 S6 S5 S4 S3 S2 S1 Xia, X Molecular Phylogenetics and Evolution 52:


Download ppt "Molecular Clock: An Interesting Application Xuhua Xia"

Similar presentations


Ads by Google