Presentation is loading. Please wait.

Presentation is loading. Please wait.

Régen DROUIN, Geneticist

Similar presentations


Presentation on theme: "Régen DROUIN, Geneticist"— Presentation transcript:

1 Régen DROUIN, Geneticist
From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

2 Cytogenetics: - Chromosome Cytogenetics - Interphase Cytogenetics
- Conventional Cytogenetics - Molecular Cytogenetics Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

3 Molecular Cytogenetic Techniques available:
FISH (Fluorescence In Situ Hybridization) & variants: Q-FISH, express FISH, etc. - PRINS (PRimed IN Situ labeling) M-FISH (Multicolor-FISH) or SKY (spectral Karyotype) Band-FISH - CGH (Comparative Genomic Hybridization) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

4 PRimed IN Situ labeling
PRINS PRimed IN Situ labeling Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

5 PRINS: Beginning PRINS technique was introduced in 1989 by Koch & al.- Dept of Cytogenetics, Société Danoise du Cancer- Aarhus, Danemark Ref. Koch J, Kolvraa S, Petersen K, Gregersen N, Bolund L, Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA In Situ.Chromosoma 1989;98:259-65 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

6 PRINS: HISTORY Method described 15 years ago, that was applied to respond to questions regarding the structure of the minute chromosomes in the primate -satellite DNA sequence. Development and Applications of PRINS (many variants of the technique have been described) There are more and more targets investigated using PRINS (many species: animals and plants) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

7 INTRODUCTION Dual-color PRINS without blocking step
Multi-PRINS and Blocking step, Dual-color PRINS without blocking step New strategy for triple-color PRINS Nucleotids labeled with Bio-dUTP & Dig-dUTP Omission of blocking step Creating new color by mixing colors Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

8 DNA Condensation and fiber-FISH
1 400nm Condensed section of chromosome Extended section of chromosome Chromatin fiber of packed nucleosomes ‘String-of-beads’ form of chromatin DNA double helix 700nm 300nm 30nm 10nm 2 nm DNA Condensation and fiber-FISH

9 A good PRINS method should have:
- An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

10 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

11 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

12 PRINS Annealing Elongation
Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada MB

13 PRINS targets : - Metaphase Chromosomes - Interphase Nuclei
- Fixed Tissues - Cells in culture Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

14 METHOD Chromosome banding Slide preparation and the thermocycler
Add Taq polymerase to the reaction solution Put the mix solution on the slide + cover slip Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

15 METHOD Add Taq polymerase to the reaction solution
Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

16 Put the mix solution on the slide + cover slip
METHOD Put the mix solution on the slide + cover slip support thermocycler

17 Detection & visualisation
METHOD Detection & visualisation Washings post-PRINS Detection using a labeled antibody Washing of the antibody + counterstaining Observation under a fluorescence microscope Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

18 Applications of the PRINS technique:
- Identification of chromosomes - Aneuploidy detection - Analysis centromere DNA - Identification of markers Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

19 Proportions (%) of nuclei carrying two signals of chromosome 8
d c u l y g 8 1 6 2 4 3 5 7 9 Proportions (%) of nuclei carrying two signals of chromosome 8 P R I N S 8 F I S H 8 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

20 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

21 Proportions (%) of nuclei carrying two signals of chromosome 7
d e t e c t i o n o f i n t e r p h a s e n u c l e i c a r r y i n g t w o s i g n a l s o f c h r o m o s o m e 7 i n 1 6 c o n t r o l c a s e s 1 2 1 8 Proportions (%) of nuclei carrying two signals of chromosome 7 6 P R I N S 7 4 F I S H 7 2 1 2 3 4 5 6 7 8 9 1 1 1 1 2 1 3 1 4 1 5 1 6 C a s e s Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

22 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

23 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

24

25 Dual-PRINS 7 (red) and 8 (green)
B C D E F PRINS 8 FISH 8 PRINS 7 FISH 7 Dual-PRINS 7 (red) and 8 (green) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

26 The development of molecular cytogenetics such as FISH and PRINS are especially important for the study of hematologic disorders. With these approaches, not only dividing cells, but also non-dividing cells can be studied for chromosome identification. PRINS technique is a good alternative to FISH to identify chromosomes both in metaphase and in interphase nuclei. Our results showed no significant difference between these two techniques regarding detection sensitivity and specificity. PRINS is more cost-effective, easier and faster than FISH. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

27 PRINS reaction and detection solutions for three chromosome targets:
Samples preparation: usual techniques PRINS reaction and detection solutions for three chromosome targets: Bio- 7 Dig- 8 Bio Avidin-fluorescein/ Anti-dig-rhodamine Dig- 7 Bio- 8 Dig Anti-dig-fluorescein/ Avidin-rhodamine System Labeling-chromosome Detection mix Triple-PRINS programming: 1st cycle: 62.5C, 10 min with first label, wash in PBS 2 min 2nd cycle: 62.5C, 10 min with second label, wash in PBS 2 min 3rd cycle: 62.5C, 10 min with third label, wash in wash buffer 2 min Detection, Counterstain and image analysis

28 Detection system 1a Detection system 2b
The results of triple-PRINS using two different labeling orders combined with two different detection systems Detection system 1a Detection system 2b Labeling order 1st signal 2nd signal 3rd signal 1st signal 2nd signal 3rd signal 1. bio-dig-bio Yellow Red Green ambiguous 2. dig-bio-dig ambiguous Yellow Red Green a: Mix of avidin-fluorescein/anti-dig-rhodamine; b: Mix of anti-dig-fluorescein/avidin-rhodamine. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

29 Primers Name Chromosome Sequence Reference  GCTTGAAATCTCCACCTGAAATGCCACAGC Koch et al c CTATCAATAGAAATGTTCAGCACAGTT Pellestor et al. 1996 18c ATGTGTGTCCTCAACTAAAG Pellestor et al. 1995 Xc X GTTCAGCTCTGTGAGTGAAA Pellestor et al. 1995 D Y TGGGCTGGAATGGAAAGGAATCGAAAC Speel et al. 1995 D Y TCCATTCGATTCCATTTTTTTCGAGAA Speel et al. 1995 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

30 A: bio-dig-bio labeling order with detection system 1
3’ 5’ The first PRINS reaction The second PRINS reaction The third PRINS reaction The first PRINS site on chromosome 7 The second PRINS site on chromosome 8 The third PRINS site on chromosome 18 : Chromosome DNA; : dNTP; : Biotin-dUTP; : Digoxigenin-dUTP; : The first primer; : The second primer; : The third primer;

31 B: dig-bio-dig labeling order with detection system 2
3’ 5’ : Chromosome DNA; : dNTP; : Biotin-dUTP; : Digoxigenin-dUTP; : The first primer; : The second primer; : The third primer. The first PRINS reaction The second PRINS reaction The third PRINS reaction The first PRINS site on chromosome 7 The second PRINS site on chromosome 8 The third PRINS site on chromosome 18

32

33 anti-dig-rhodamin detection
bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

34 bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

35 anti-dig-rhodamin detection
bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

36 anti-dig-fluorescein/ avidin-rhodamin detection
dig-bio-dig labeling, anti-dig-fluorescein/ avidin-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

37 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

38 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

39 XY normal <==Multi-PRINS FISH==>

40 47,XX,+18 <==Multi-PRINS FISH==>

41 Main advantages of the PRINS technique:
Semi-automated Protocole because of the use of thermocycler Simple, reproducible and reliable method Very good ratio cost benefit Short duration of the reaction (on the average) Availability of any primers (automatic synthesizer) The specificity and small size of the primers (18 à 35 mer) does not generate cross reaction Specificity of centromeric sequences of chromosomes 13 and 21 More efficient in some cells with more condensed nuclei: the size of primer is much smaller than the size of the probe thus making it easier to pass the nuclear membrane and hybridize to the target DNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

42 Main advantages of the PRINS technique:
Detection of unique intragenic sequences Very low background because of the absence of labeling directly on the primer and the rapidity of the reaction Good preservation of the integrity of the chromosome structure due to the short incubation time Multi-target detection: it is very easy to do multi-color PRINS or combine with FISH to simultaneously detect different chromosomes in the same cells. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

43 Powerful technique, simple and universal
CONCLUSIONS Technique PRINS Powerful technique, simple and universal Represents a very good alternative to FISH Future Perspectives Detection of fusion genes Detection of female foetal cells using the technique of PRINS-RNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

44 Applications of the FISH and PRINS techniques:
- Identification of chromosomes - Détection of aneuploïdies - Analysis of centromeric DNA - Identification of marker chromosomes Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

45 A good PRINS method should have:
- An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

46 Same nucleus in both panels is shown with the opposite colours
Simultaneous FISH analysis using sex chromosome specific probes: the red signal correspond to the X chromosome and the blue signal to the Y chromosome Simultaneous reverse FISH analysis using sex chromosome specific probes: the red signal correspond to the Y chromosome and the blue signal to the X chromosome

47

48

49 FISH technique (LSI-21 probe) combined
to PRINS reaction (Y primer sequence) Male fetal cell with 3 copies of Chromosome 21 (red signals) and 1 copy of the Y chromosome (green signal)

50 Male fetal cell with trisomy 18
PRINS technique Male fetal cell with trisomy 18

51 Fetal cell with trisomy 18 detected by PRINS technique

52 PRINS (primer centromeric oligonucleotide 8 Fetal cell with triploidy
Fetal triploid cell detected by PRINS technique using centromeric oligonucleotide primer specific to the chromosome 7 (the nucleus with three red signals)

53 Triploidic fetal cell with 3 copies of chromosome 7
PRINS technique Triploidic fetal cell with 3 copies of chromosome 7

54

55

56

57

58 CONCLUSIONS It is possible to detect fetal cells in every pregnant woman during the pregnancy. Using molecular cytogenetic approaches, (FISH and PRINS), we showed that there were between 2 and 6 fetal cells per mL of maternal blood The low fluctuation between the 12 pregnant women we studied is likely due to personal characteristics specific to each of the women. The number of fetal cells in the maternal blood does not appear to be influenced by previous pregnancies.

59 CONCLUSION It is possible to detect fetal cells between millions of maternal blood cells (our previous results : 2 to 6 fetal cells per mL of maternal blood, see ref.3) using molecular cytogenetic techniques (FISH et PRINS) In agreement with several reports, our preliminary results obtained with 14 pregnant women show a 5-fold higher number of fetal cells in pregnancies associated with aneuploid conceptuses (see Tables 1, 2 & 3) This finding provides an interesting perspective for the development of a safe and convenient non-invasive molecular cytogenetic prenatal diagnosis for the most common fetal chromosomal aneuploidies (13, 18, 21, X and Y). However, this procedure is time consuming and labour intensive. More studies are needed to confirm the robustness of this methodology and automation will be required before widespread application. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

60 Incomplete Replication
Telomere Simple DNA sequence (T2AG3) tandemly repeated, of variable length, located at the extremities of the chromosomes. Telomeres are essential elements that protect the extremities of the chromosomes from degradation and ligation. Shortening Elongation Equilibrium Incomplete Replication Addition of repetitions T2AG3 by the telomerase Nuclease Activity Senescence Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

61 Telomeres Specialized structures made of DNA and PROTEINS
Repeated DNA sequence: 2 à 15 kb TTAGGG AATCCC Maintain the chromosome stability Around 30 to 120 bp are lost per somatic cell division Too short : cellular senescence and genetic instability Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

62 Measurement of telomeres
Average length of telomeres : Measurement of terminal restriction fragments. Digestion using restriction enzymes of purified DNA Visualization and measurements of telomeric fragments by Southern blot Cleavage of telomeres at variable distance No information individual telomeres Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

63 Measurement of telomeres
Length of individual telomeres : Quantitative FISH (Q-FISH) Hybridization telomeric PNA probes Measurements of the signal intensity Length Profil of individual telomeres Variation of hybridization efficiency ??? Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

64 Marquage par synthèse in situ amorcée
PRINS Marquage par synthèse in situ amorcée Appariement Élongation Tissus Cellules Chromosomes Fibres d’ADN The PRINS reaction The primer sequence is complementary to the telomeric sequence: (CCCTAA)7 Koch et al., 1995 Terkelsen et al., 1995

65 Wrn ∆hel/ ∆hel Figure 3: 11-dUTP-digoxigénine 62.5 °C, 10 minutes
Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada 62.5 °C, 10 minutes

66 Le double-PRINS To increase the efficiency of the telomere labeling using PRINS, Dr Ju Yan developed an innovative double-labeling technique : two complementary primers, (CCCTAA)7 et (TTAGGG)7, are used to label both DNA strands of the telomere sequences. : (TTAGGG)7 A A : (CCCTAA)7 C B B C Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

67 PRINS Reaction Hybridization and elongation : 20 minutes at 63°C,
Materials & méthods PRINS Reaction 1. The PRINS mixture is put on the slide : dNTP, labeled dUTP (biotine or digoxigenine), primers, Taq buffer & Taq polymerase Hybridization and elongation : minutes at 63°C, on a thermocycler.

68 Double-PRINS Procedure
Materials & methods Double-PRINS Procedure 1. 1st PRINS reaction : primer (CCCTAA)7. 2. Brief washings (washing buffer then PBS 1x ). 3. 2nd PRINS reaction : primers (TTAGGG)7. 4. Washings (washing buffer : 5 min. at 45oC and 2 x 5 min. at room To). 5. Revelation of the signals : fluorescent antibodies. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

69 Image Analysis Materials & methods
40 metaphases per case, 10 for each type of signals : - green signals only - red signals only - double color signals - double green signals Analyzed using the ISIS 2 software of Metasystems Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

70 1. Comparison between simple PRINS and PNA-FISH
Results 1. Comparison between simple PRINS and PNA-FISH One PRINS cycle PNA-FISH Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

71 2. Double-PRINS double color
Results 2. Double-PRINS double color

72 3. Comparison between simple PRINS and double-PRINS
Results 3. Comparison between simple PRINS and double-PRINS Green only Red only Double color

73 4. Comparison between double-green double-PRINS & PNA-FISH
Results 4. Comparison between double-green double-PRINS & PNA-FISH Double-vert PNA-FISH Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

74 Results Marquage des chromatides Marquage des bras des chromosomes
Vert Rouge Double couleur Double vert PNA Vert Rouge Double couleur Double vert PNA Marquage des chromatides Marquage des bras des chromosomes Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

75 Telomere signals on chromatin fibers (arrows) detected
by double-green labelling using PRINS. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

76 Labeling: Biotin-dUTP
Fig. 4: Single-copy sequence detected by multi-primer PRINS technique. Locus: AL672294, 37kb on chromosome 1q subtelomere, 28 primers. Labeling: Biotin-dUTP Detection: Avidin-FITC

77 Team of Dr Régen DROUIN Cytogenetics Molecular Genetics Walid DRIDI
Macoura GADJI Kada KRABCHI Josée LAVOIE Sandrine LACOSTE Stéphane OUELLET Patrick ROCHETTE François VIGNEAULT Éric BOUCHARD Marc BRONSARD Nathalie BASTIEN Mélissa FERLAND Isabelle PARADIS Ju YAN Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada


Download ppt "Régen DROUIN, Geneticist"

Similar presentations


Ads by Google