Presentation is loading. Please wait.

Presentation is loading. Please wait.

From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de.

Similar presentations


Presentation on theme: "From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de."— Presentation transcript:

1 From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

2 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Cytogenetics: - Chromosome Cytogenetics - Interphase Cytogenetics - Conventional Cytogenetics - Molecular Cytogenetics

3 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Molecular Cytogenetic Techniques available: - FISH (Fluorescence In Situ Hybridization) & variants: Q-FISH, express FISH, etc. - PRINS (PRimed IN Situ labeling) - M-FISH (Multicolor-FISH) or SKY (spectral Karyotype) - Band-FISH - CGH ( Comparative Genomic Hybridization )

4 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada PRINS PRimed IN Situ labeling

5 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada PRINS : Beginning PRINS technique was introduced in 1989 by Koch & al.- Dept of Cytogenetics, Société Danoise du Cancer- Aarhus, Danemark Ref. Koch J, Kolvraa S, Petersen K, Gregersen N, Bolund L, Oligonucleotide-priming methods for the chromosome- specific labelling of alpha satellite DNA In Situ.Chromosoma 1989;98:259-65

6 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada PRINS : HISTORY Method described 15 years ago, that was applied to respond to questions regarding the structure of the minute chromosomes in the primate  -satellite DNA sequence. Development and Applications of PRINS (many variants of the technique have been described) There are more and more targets investigated using PRINS (many species: animals and plants)

7 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada l Multi-PRINS and Blocking step, l Dual-color PRINS without blocking step l New strategy for triple-color PRINS l Nucleotids labeled with Bio-dUTP & Dig-dUTP l Omission of blocking step l Creating new color by mixing colors

8 DNA Condensation and fiber- FISH 1 400nm Condensed section of chromosome Extended section of chromosome Chromatin fiber of packed nucleosomes ‘String-of-beads’ form of chromatin DNA double helix 700nm 300nm 30nm 10nm 2 nm

9 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal

10 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

11

12 PRINS AnnealingElongation MB

13 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada PRINS targets : - Metaphase Chromosomes - Interphase Nuclei - Fixed Tissues - Cells in culture

14 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Slide preparation and the thermocycler Add Taq polymerase to the reaction solution Put the mix solution on the slide + cover slip Chromosome banding METHOD

15 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada METHOD Add Taq polymerase to the reaction solution

16 METHOD support thermocycler Put the mix solution on the slide + cover slip

17 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada METHOD Washings post-PRINS Detection using a labeled antibody Washing of the antibody + counterstaining Observation under a fluorescence microscope Detection & visualisation

18 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Applications of the PRINS technique: - Identification of chromosomes - Aneuploidy detection - Analysis centromere DNA - Identification of markers

19 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada PRINS 8 FISH 8 Proportions (%) of nuclei carrying two signals of chromosome 8

20 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

21 Comparison of PRINS with FISH in the detection of interphase nuclei carrying two signals of chromosome 7 in 16 control cases Cases PRINS 7 FISH 7 Proportions (%) of nuclei carrying two signals of chromosome 7

22 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

23

24

25 A B C D E F PRINS 8 FISH 8 PRINS 7 FISH 7 Dual-PRINS 7 (red) and 8 (green)

26 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada lThe development of molecular cytogenetics such as FISH and PRINS are especially important for the study of hematologic disorders. With these approaches, not only dividing cells, but also non- dividing cells can be studied for chromosome identification. lPRINS technique is a good alternative to FISH to identify chromosomes both in metaphase and in interphase nuclei. Our results showed no significant difference between these two techniques regarding detection sensitivity and specificity. PRINS is more cost-effective, easier and faster than FISH.

27 Samples preparation: usual techniques PRINS reaction and detection solutions for three chromosome targets: 1 Bio- 7 Dig- 8 Bio- 18 Avidin-fluorescein/ Anti-dig-rhodamine 2 Dig- 7 Bio- 8 Dig- 18 Anti-dig-fluorescein/ Avidin-rhodamine System Labeling-chromosome Detection mix Triple-PRINS programming: 1st cycle: 62.5  C, 10 min with first label, wash in PBS 2 min 2nd cycle: 62.5  C, 10 min with second label, wash in PBS 2 min 3rd cycle: 62.5  C, 10 min with third label, wash in wash buffer 2 min Detection, Counterstain and image analysis

28 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Labeling order 1st signal 2nd signal 3rd signal 1. bio-dig-bio Yellow Red Green ambiguous 2. dig-bio-dig ambiguous Yellow Red Green Detection system 1 a Detection system 2 b The results of triple-PRINS using two different labeling orders combined with two different detection systems a: Mix of avidin-fluorescein/anti-dig-rhodamine; b: Mix of anti-dig-fluorescein/avidin-rhodamine.

29 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Primers Name Chromosome Sequence Reference  -7 7 GCTTGAAATCTCCACCTGAAATGCCACAGC Koch et al c 8 CTATCAATAGAAATGTTCAGCACAGTT Pellestor et al c 18 ATGTGTGTCCTCAACTAAAG Pellestor et al Xc X GTTCAGCTCTGTGAGTGAAA Pellestor et al D599 Y TGGGCTGGAATGGAAAGGAATCGAAAC Speel et al D600 Y TCCATTCGATTCCATTTTTTTCGAGAA Speel et al. 1995

30

31

32

33 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

34 bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

35 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

36 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada dig-bio-dig labeling, anti-dig-fluorescein/ avidin-rhodamin detection

37 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

38

39 XY normal <==Multi-PRINS FISH==>

40 47,XX,+18 <==Multi-PRINS FISH==>

41 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Main advantages of the PRINS technique: *Semi-automated Protocole because of the use of thermocycler *Simple, reproducible and reliable method *Very good ratio cost benefit *Short duration of the reaction (on the average) *Availability of any primers (automatic synthesizer) *The specificity and small size of the primers (18 à 35 mer) does not generate cross reaction *Specificity of centromeric sequences of chromosomes 13 and 21 *More efficient in some cells with more condensed nuclei: the size of primer is much smaller than the size of the probe thus making it easier to pass the nuclear membrane and hybridize to the target DNA

42 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Main advantages of the PRINS technique: *Detection of unique intragenic sequences *Very low background because of the absence of labeling directly on the primer and the rapidity of the reaction *Good preservation of the integrity of the chromosome structure due to the short incubation time *Multi-target detection: it is very easy to do multi-color PRINS or combine with FISH to simultaneously detect different chromosomes in the same cells.

43 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada CONCLUSIONS  Technique PRINS Powerful technique, simple and universal Represents a very good alternative to FISH  Future Perspectives Detection of fusion genes Detection of female foetal cells using the technique of PRINS-RNA

44 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Applications of the FISH and PRINS techniques: - Identification of chromosomes - Détection of aneuploïdies - Analysis of centromeric DNA - Identification of marker chromosomes

45 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal

46 Simultaneous FISH analysis using sex chromosome specific probes: the red signal correspond to the X chromosome and the blue signal to the Y chromosome Simultaneous reverse FISH analysis using sex chromosome specific probes: the red signal correspond to the Y chromosome and the blue signal to the X chromosome Same nucleus in both panels is shown with the opposite colours

47

48

49 Male fetal cell with 3 copies of Chromosome 21 (red signals) and 1 copy of the Y chromosome (green signal) FISH technique (LSI-21 probe) combined to PRINS reaction (Y primer sequence)

50 Male fetal cell with trisomy 18 PRINS technique

51 Fetal cell with trisomy 18 detected by PRINS technique

52 PRINS (primer centromeric oligonucleotide 8 Fetal cell with triploidy Fetal triploid cell detected by PRINS technique using centromeric oligonucleotide primer specific to the chromosome 7 (the nucleus with three red signals)

53 PRINS technique Triploidic fetal cell with 3 copies of chromosome 7

54

55

56

57

58 CONCLUSIONS  It is possible to detect fetal cells in every pregnant woman during the pregnancy. Using molecular cytogenetic approaches, (FISH and PRINS), we showed that there were between 2 and 6 fetal cells per mL of maternal blood  The low fluctuation between the 12 pregnant women we studied is likely due to personal characteristics specific to each of the women.  The number of fetal cells in the maternal blood does not appear to be influenced by previous pregnancies.

59 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada CONCLUSION  It is possible to detect fetal cells between millions of maternal blood cells (our previous results : 2 to 6 fetal cells per mL of maternal blood, see ref.3) using molecular cytogenetic techniques (FISH et PRINS)  In agreement with several reports, our preliminary results obtained with 14 pregnant women show a 5-fold higher number of fetal cells in pregnancies associated with aneuploid conceptuses (see Tables 1, 2 & 3)  This finding provides an interesting perspective for the development of a safe and convenient non-invasive molecular cytogenetic prenatal diagnosis for the most common fetal chromosomal aneuploidies (13, 18, 21, X and Y).  However, this procedure is time consuming and labour intensive. More studies are needed to confirm the robustness of this methodology and automation will be required before widespread application.

60 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Telomere Simple DNA sequence (T 2 AG 3 ) tandemly repeated, of variable length, located at the extremities of the chromosomes. ShorteningElongation Incomplete Replication Nuclease Activity Addition of repetitions T 2 AG 3 by the telomerase Equilibrium Telomeres are essential elements that protect the extremities of the chromosomes from degradation and ligation. Senescence

61 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Maintain the chromosome stability Telomeres Specialized structures made of DNA and PROTEINS TTAGGG AATCCC TTAGGG AATCCC TTAGGG AATCCC Repeated DNA sequence: 2 à 15 kb Around 30 to 120 bp are lost per somatic cell division Too short : cellular senescence and genetic instability

62 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Measurement of telomeres Average length of telomeres : Measurement of terminal restriction fragments. –Digestion using restriction enzymes of purified DNA –Visualization and measurements of telomeric fragments by Southern blot Cleavage of telomeres at variable distance No information individual telomeres

63 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Measurement of telomeres Length of individual telomeres : Quantitative FISH (Q-FISH) Hybridization telomeric PNA probes Measurements of the signal intensity Length Profil of individual telomeres Variation of hybridization efficiency ???

64 The PRINS reaction Koch et al., 1995 Terkelsen et al., 1995 PRINS Marquage par synthèse in situ amorcée Appariement Élongation TissusCellulesChromosomes Fibres d’ADN The primer sequence is complementary to the telomeric sequence: (CCCTAA) 7

65 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Wrn ∆hel/ ∆hel 11-dUTP-digoxigénine 62.5 °C, 10 minutes Figure 3:

66 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Le double-PRINS To increase the efficiency of the telomere labeling using PRINS, Dr Ju Yan developed an innovative double-labeling technique : two complementary primers, (CCCTAA) 7 et (TTAGGG) 7, are used to label both DNA strands of the telomere sequences. A B C A B C : (TTAGGG) 7 : (CCCTAA) 7

67 PRINS Reaction 1.The PRINS mixture is put on the slide : dNTP, labeled dUTP (biotine or digoxigenine), primers, Taq buffer & Taq polymerase 2.Hybridization and elongation : 20 minutes at 63°C, on a thermocycler. Materials & méthods

68 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Double-PRINS Procedure Materials & methods 1.1 st PRINS reaction : primer (CCCTAA) 7. 2.Brief washings (washing buffer then PBS 1x ). 3.2 nd PRINS reaction : primers (TTAGGG) 7. 4.Washings (washing buffer : 5 min. at 45 o C and 2 x 5 min. at room T o ). 5.Revelation of the signals : fluorescent antibodies.

69 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Image Analysis 40 metaphases per case, 10 for each type of signals : - green signals only - red signals only - double color signals - double green signals Analyzed using the ISIS 2 software of Metasystems Materials & methods

70 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada 1. Comparison between simple PRINS and PNA-FISH One PRINS cyclePNA-FISH Results

71 2. Double-PRINS double color Results

72 Green only 3. Comparison between simple PRINS and double-PRINS Results Red only Double color

73 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada 4. Comparison between double-green double-PRINS & PNA-FISH Double-vertPNA-FISH Results

74 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Marquage des chromatidesMarquage des bras des chromosomes Vert Rouge Double couleur Double vert PNA Results

75 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Telomere signals on chromatin fibers (arrows) detected by double-green labelling using PRINS.

76 Fig. 4: Single-copy sequence detected by multi-primer PRINS technique. Locus: AL672294, 37kb on chromosome 1q subtelomere, 28 primers. Labeling: Biotin-dUTP Detection: Avidin-FITC

77 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada Team of Dr Régen DROUIN Cytogenetics Molecular Genetics Walid DRIDI Macoura GADJI Kada KRABCHI Josée LAVOIE Éric BOUCHARD Marc BRONSARD Ju YAN Sandrine LACOSTE Stéphane OUELLET Patrick ROCHETTE François VIGNEAULT Nathalie BASTIEN Mélissa FERLAND Isabelle PARADIS


Download ppt "From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de."

Similar presentations


Ads by Google