Presentation is loading. Please wait.

Presentation is loading. Please wait.

Current Perspectives: Clinical Applications For Whole Genome Sequencing Richard A. Leach, Ph.D. Vice President | Business Development | Complete Genomics.

Similar presentations


Presentation on theme: "Current Perspectives: Clinical Applications For Whole Genome Sequencing Richard A. Leach, Ph.D. Vice President | Business Development | Complete Genomics."— Presentation transcript:

1 Current Perspectives: Clinical Applications For Whole Genome Sequencing Richard A. Leach, Ph.D. Vice President | Business Development | Complete Genomics

2 Conflict of Interest Disclosure Vice President | Business Development Board Member | Stakeholder

3 1.Understand the process of Whole Genome Sequencing (WGS) from tissue to data 2.Become familiar with relevant WGS quality metrics, genomic variants 3.Current perspective on clinical utility studies for WGS 4.Learn current and future clinical applications of WGS with some emphasis on preimplantation genetic diagnosis (PGD screening) and parental carrier screening 5.Clinical examples of WGS CME Learning Objectives

4 1.Understand the process of Whole Genome Sequencing (WGS) from tissue to data 2.Become familiar with relevant WGS quality metrics, genomic variants 3.Current perspective on clinical utility studies for WGS 4.Learn current and future clinical applications of WGS with some emphasis on preimplantation genetic diagnosis (PGD screening) and parental carrier screening 5.Clinical examples of WGS CME Learning Objectives

5 DNA Sequencing: Interrogating The 1° Structure Assign Variant Annotation & Interpret for Clinic C – 3’ T A T G C T C G C A T G A C T C A T A C G – 5’ Align & Compare Reference DNA Sequence “Call’ the Variant Chain Termination AKA: Sanger Sequencing 3’ – X X 5’ – X Unknown Patient DNA Sequence ATGCTTCGGCAAGACTCAAAAAATAATGCTTCGGCAAGACTCAAAAAATA Known Patient DNA Sequence “Read” length ~700 bases

6 DNA Sequencing: Genomic Variation Genomic variants are either inherited or de novo Single Nucleotide Polymorphism (SNP) Tandem Repeats (STR, microsatellite) Insertion Deletion Amplification Inversion Translocation Aneuploidy Genomic Variation = Different from Reference Reference DNA Sequence C – 3’ T A T G C T C G C A T G A C T C A T A C G – 5’ Align & Compare “Call’ the Variant ATGCTTCGGCAAGACTCAAAAAATAATGCTTCGGCAAGACTCAAAAAATA Known Patient DNA Sequence “Read” length ~700 bases Pathogenic?

7 PATIENT 5’- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX - 3’ Next Generation Sequencing Next Generation = Massively Parallel TGAACTAGTCTCGGA “Read” length bases REFERENCE 5’- AGTGCCATTTCGATGAACATGTCTCGGACCCGTAATGGTCTCTTGGGTCTGAA - 3’ CCATTTCGATGAACT GATGAACTAGTCTCG ACTAGTCTCGGACCC TCGATGAACTAGTCT GTGCCATTTCGATGA CTAGTCTCGGACCCG ATTTCGATGAACTAG TTTCGATGAACTAGT GACCCGTAATGGTCT CTCGGACCCGTAATG CGATGAACTAGTCTC TAT False PositiveFalse Negative Correct “Read Depth” “Depth of Coverage” “Coverage” “X-Fold Coverage” Call Rate & Accuracy

8 Next Next Generation Sequencing Next Next Generation = Massively Parallel Massively Parallel Next GenerationSangerNext Next Generation Highly Centralized Sequencing Factories -or- Highly Distributed Desktop Sequencers

9 DNA Sequencing: Approaches to the Genome Genotyping: Known SNP’s & Microsatellites Targeted: Known finite regions Whole Exome: Coding region (~1% of total) Targeted Exome Capture (~180,000 exons) No non-coding DNA (i.e. no introns, regulatory regions, etc.) Whole Genome: Everything SangerNext GenNext Next GenMicroarray

10 PATIENT Sample Acquisition Accessioning Genomic DNA Isolation gDNA Quality Control Library Construction SequencingImagingAssembly Variant Calling Variant Annotation Data Packaging & Delivery Clinical Interpretation Report Generation Results Delivery Process of Clinical Genome Sequencing

11 Economics of Genome Sequencing : $2,300 / 15 days 100,000 $2.3K 20K $5K 9 $350K Cost Per Genome$2MM : $2,300,000,000 / 15 years Number of Whole Genomes Sequenced 1

12 1.Understand the process of Whole Genome Sequencing (WGS) from tissue to data 2.Become familiar with relevant WGS quality metrics, genomic variants 3.Current perspective on clinical utility studies for WGS 4.Learn current and future clinical applications of WGS with some emphasis on preimplantation genetic diagnosis (PGD screening) and parental carrier screening 5.Clinical examples of WGS CME Learning Objectives

13 Many interwoven and complicated challenges for clinical adoption of WGS as standard of care WGS: Basic milestones for clinical adoption Platform Validity Proof of Clinical Utility Health Economic Benefit Moving WGS to the Clinic

14 “A test that is analytically sound but has no established clinical utility should not be offered clinically.” Jennings, et al. Recommended Principles & Practices for Validating Clinical Molecular Pathology Tests. Arch Pathol Lab Med. V133, May 2009 “…expresses- preferably in a quantitative form- to what extent diagnostic testing improves health outcomes relative to the current best alternative.” Bossuyt, et al. Beyond Clinical Diagnostic Accuracy: The Clinical Utility of Diagnostic Tests. Clinical Chemistry- V58, December 2012 WGS: Proving Clinical Utility

15 Global program of basic collaborative studies Results published in leading clinical journals 1° Goal: Compare diagnostic yield of WGS versus existing standard of care 2° Goal: Demonstrate applications of WGS 2° Goal: Study Health Economic Benefit Clinical Utility Study Program

16 18 collaborative studies ongoing Cardiology Congenital Malformation Developmental Delay / Intellectual Disability Health Economics Neurology Newborn Screening Oncology Ophthalmology Pathology WGS: Current Clinical Utility Studies

17 Clinical Utility Study Program

18 Prof. Ahmed Ashour Ahmed Intra-operative monitoring of High Grade Serous Ovarian Cancer Multiple fine-needle biopsies from a single tumor before and after chemotherapy Used CGI Long Fragment Read Technology* Study completed, manuscript submitted UK *Peters & Drmanac, et al. Nature, Vol. 487, July 2012 Oncology: Oxford Weatherall Institute

19 Large Epilepsy study – hundreds of genomes Brain surgery is current standard of care for certain debilitating epilepsies Utility of WGS for surgical outcome prediction UK Epilepsy: UCL / NHS

20 Diagnostic yield of WGS vs. clinical microarray Prospective study: clinical assay performed in parallel with WGS Assessing frequency of medically actionable variants unrelated to 1° reason for testing Initial results very exciting Canada ASD / DDID / Malformation

21 Prof. Han Brunner, Prof. Joris Veltman Severe ID usually due to de novo variation Diagnostic Yield of WGS vs. exome Previous exome study published in NEJM Current study 50 exome negative trios Variants in exome & regulatory regions Focus on de novo events Netherlands Intellectual Disability: RUNMC

22 2012: Diagnostic Exome 100 ID Trios All negative by Sanger, Microarray Netherlands De Ligt, et al. New Engl J Med. Vol 367, November 2012 POSITIVE DIAGNOSISNUMBER OF PATIENTS (n=100) All Mutations16 De Novo Mutations13 Autosomal Dominant10 Autosomal Recessive1 X-Linked2 Inherited Mutations3 Autosomal Dominant0 Autosomal Recessive0 X-Linked3 Candidate Causal Variants19 No Diagnosis65 16% Diagnostic Yield

23 2013: Whole Genome 50 ID trios All negative by Sanger, Microarray, Exome Netherlands POSITIVE DIAGNOSISNUMBER OF PATIENTS (n=50) All Mutations19 De Novo Mutations18 Autosomal Dominant14 Autosomal Recessive0 X-Linked4 Inherited Mutations1 Autosomal Dominant0 Autosomal Recessive1 X-Linked0 Candidate Causal Variants8 No Diagnosis23 38% Diagnostic Yield

24 Netherlands Evolution of Diagnostic Yield for ID

25 1.Understand the process of Whole Genome Sequencing (WGS) from tissue to data 2.Become familiar with relevant WGS quality metrics, genomic variants 3.Current perspective on clinical utility studies for WGS 4.Learn current and future clinical applications of WGS with some emphasis on preimplantation genetic diagnosis (PGD screening) and parental carrier screening 5.Clinical examples of WGS CME Learning Objectives

26 P4 MEDICINE Wellness focused Personalized Preventive Predictive Participatory Proactive Medicine Why do WGS for the clinic? PERSONALIZED MEDICINE / PRECISION MEDICINE Treatment focused Uses panomics to select the right treatment for the right person at the right time. Reactive Medicine To extend and improve the quality of human life.

27

28 Pharmacogenomics Good Drug Antiplatelet CYP2C19 variant >15% non-metabolizers FDA black box warning ~$1BB wasted per year

29 abacavirclopidogrelfulvestrantmoclobemideprimaquinethioguanine acenocoumarolclozapinegalantaminemodafinilprobenecidthioridazine acetaminophencodeinegefitinibmycophenolic acidpropafenoneticagrelor allopurinolcrizotinibglibenclamidenalidixic acidpropranololtimolol amitriptylinedapsonegliclazidenelfinavirprotriptylinetiotropium aripiprazoledasatinibglimepiridenilotinibpyrazinamidetolbutamide arsenic trioxidedenileukin diftitoxhaloperidolnitrofurantoinquinidinetolterodine atomoxetinedesipraminehormonal contraceptivesnorfloxacinrabeprazoletositumomab atorvastatindextromethorphanhydralazinenortriptylinerasburicasetramadol azathioprinediazepamiloperidoneolanzapineribavirintrastuzumab boceprevirdoxepinimatinibomeprazolerifampintrastuzumab emtansine brentuximab vedotindrospirenoneimipramineoxycodonerisperidonetretinoin capecitabineduloxetineindacaterolpanitumumabsertralinetrimethoprim carbamazepineeltrombopagirinotecanpantoprazolesimvastatintrimipramine carisoprodolerlotinibisoniazidparoxetinesodium benzoatevalproic acid carvedilolescitalopramisosorbide dinitratepeginterferon alfa-2bsulfadiazinevemurafenib celecoxibesomeprazoleivacaftorpegloticasesulfamethoxazolevenlafaxine cetuximabethinyl estradiollansoprazoleperphenazinesulfasalazinevoriconazole cevimelineeverolimuslapatinibPertuzumabsulfisoxazolewarfarin chloroquineexemestaneletrozolephenprocoumontacrolimuszuclopenthixol cisplatinflecainidemaravirocphenylacetic acidtamoxifen citalopramfluorouracilmercaptopurinephenytointegafur clobazamfluoxetinemethylene bluepimozidetelaprevir clomifeneflurbiprofenmetoprololprasugrelterbinafine clomipraminefluvoxaminemirtazapinepravastatintetrabenazine Pharmacogenomics

30 Parental Screening / Family Planning Alpha-Thalassemia Beta-Thalassemia Bloom Syndrome Canavan Disease Cystic Fibrosis Familial Dysautonomia Familial Hyperinsulinism Fanconi Anemia Fragile X Syndrome Gaucher Disease (Type I) Glycogen Storage Disease 1A Joubert Syndrome 2 Lipoamide Dehydrogenase Deficiency Maple Syrup Urine Disease Mucopolipidosis IV Neiman Pick Type A Nemaline Myopathy Spinal Muscular Atrophy Tay-Sachs Disease Usher Syndrome Walker-Warburg Syndrome Current targeted screening will be replaced by whole genome screening.

31 Pre-Symptomatic Diagnosis Richard A. Leach, Ph.D. Jeffrey Gulcher, M.D., Ph.D.

32 Dimmock Mayer Jacob Margolis Verbsky Worthey Idiopathic Disease Resolution Nick Volker

33 LFR: A Major Sequencing Advancement

34 Long Fragment Read (LFR) 10 cells starting material <600 errors per diploid genome Phased – 98% Identify de novo variants Parent of origin

35 Current Perspectives: Clinical Applications For Whole Genome Sequencing Richard A. Leach, Ph.D. Vice President | Business Development | Complete Genomics


Download ppt "Current Perspectives: Clinical Applications For Whole Genome Sequencing Richard A. Leach, Ph.D. Vice President | Business Development | Complete Genomics."

Similar presentations


Ads by Google