Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA Review  RNA is just like DNA, except that it is only one strand, instead of two.  The other difference is that RNA replaces all of the THYMINE with.

Similar presentations


Presentation on theme: "RNA Review  RNA is just like DNA, except that it is only one strand, instead of two.  The other difference is that RNA replaces all of the THYMINE with."— Presentation transcript:

1

2 RNA Review  RNA is just like DNA, except that it is only one strand, instead of two.  The other difference is that RNA replaces all of the THYMINE with URACIL.  So, C still pairs with G.  Cytosine with Gaunine  But now, A pairs with U.  Adenine with Uracil

3 RNA Review  RNA is like a photocopy of the DNA. It is what actually gets sent out to the ribosomes for building proteins.  The CEO (the nucleus) does not want to let the DNA out of his reach. It is way way too long and the CEO needs it to replicate!  It is needed to replicate new DNA, if the cell ever needs to make a new cell or reproduce. Plus, it contains instructions for everything  So, the CEO (nucleus) decides to make a photocopy of the DNA to send out to the WORKERS (ribosomes).  The RNA is specific to one protein. For example, it could just build protein, or hemoglobin.  This is the RNA! We call it mRNA for MESSENGER RNA!

4 Transcription Review  mRNA is created through the process of TRANSCRIPTION!  Just like DNA replication, transcription occurs by splitting the DNA apart. However, in transcription it is only temporary.  Then, the mRNA strand pairs up with one strand of DNA and base pairs come together.  The only difference is mRNA pairs A with U (it still pairs T with A).  Finally, the DNA molecule comes back together and the mRNA head off for the ribosomes (workers) to build proteins.

5 Transcription and Translation  Transcription is the process that creates a photocopy of the instructions.  The instructions are the DNA. The photocopy is the mRNA  Translation is the process in which the workers read the photocopy to create proteins.  The workers are the ribosomes  Let’s read a story about it…  But first, what is an analogy?  A comparison between two things

6 Translation  Translation starts with the mRNA leaving the nucleus for the cytoplasm  A ribosome grabs hold of a strand of mRNA and starts to read it, three letters at a time.  Each 3 letter section of mRNA is called a CODON.  Each codon represents an amino acid that will be added to the chain.

7 What is a codon?  Remember, a GENE is like a sentence in the genetic code  ACGUUGCCAAGCAAUCG (or HASBROWNHAIR)  Then, A CODON is like a word  Each codon tells the ribosome which AMINO ACID to use  A codon is 3 letters  Ex. CAG means glutamine  Some codons mean “Start” or “Stop”  A BASE is like a letter  A, U, G, C

8 Building Proteins  As the ribosome reads the mRNA, transfer molecules (tRNA) fetch amino acids and bring them back to the ribosome.  The transfer molecules line up with the correct codon and add their amino acid to the growing chain.  Eventually, the rib0some reads “stop” and the protein chain is complete! Let’s try translating some proteins!

9

10 Let’s see it in action…  eature=channel eature=channel  nscribe/ nscribe/

11 Let’s Try it!  TRANSCRIPTION: First, translate the DNA into mRNA.  DNA: TAAGCTACCTTCGCATGGCATGCATC  mRNA: AUUCGAUGGAAGCGUACCGUACGUAG  TRANSLATION: Next, read the mRNA from left to right, looking for the “start” codon AUG.  TRANSLATION: Now, read one codon at a time and use your codon chart to find the correct AMINO ACID  TRANSLATION: Once you get to the stop codon, you’re chain of amino acids is complete and you have created a protein!

12 Now, try it on your own.

13 Exit Slip  1) What is a codon?  2) Describe the process of translation in your own words:


Download ppt "RNA Review  RNA is just like DNA, except that it is only one strand, instead of two.  The other difference is that RNA replaces all of the THYMINE with."

Similar presentations


Ads by Google